Incidental Mutation 'R7300:Serpinb8'
ID566904
Institutional Source Beutler Lab
Gene Symbol Serpinb8
Ensembl Gene ENSMUSG00000026315
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 8
SynonymsCAP2, Spi8, CAP-2, NK10, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location107590006-107610484 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 107607323 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 375 (*375K)
Ref Sequence ENSEMBL: ENSMUSP00000000514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000514] [ENSMUST00000112706] [ENSMUST00000123086]
Predicted Effect probably null
Transcript: ENSMUST00000000514
AA Change: *375K
SMART Domains Protein: ENSMUSP00000000514
Gene: ENSMUSG00000026315
AA Change: *375K

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112706
AA Change: *375K
SMART Domains Protein: ENSMUSP00000108326
Gene: ENSMUSG00000026315
AA Change: *375K

DomainStartEndE-ValueType
SERPIN 13 374 1.69e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123086
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Serpinb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Serpinb8 APN 1 107606984 missense probably benign 0.01
IGL01309:Serpinb8 APN 1 107604718 missense probably damaging 1.00
IGL03210:Serpinb8 APN 1 107602911 missense probably damaging 1.00
Hachi UTSW 1 107597471 start codon destroyed probably null 1.00
IGL02835:Serpinb8 UTSW 1 107602856 missense probably damaging 1.00
R0284:Serpinb8 UTSW 1 107602918 critical splice donor site probably null
R1087:Serpinb8 UTSW 1 107606997 missense probably damaging 0.99
R1728:Serpinb8 UTSW 1 107597527 missense probably benign
R1728:Serpinb8 UTSW 1 107598954 missense probably benign
R1728:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1729:Serpinb8 UTSW 1 107597527 missense probably benign
R1729:Serpinb8 UTSW 1 107598954 missense probably benign
R1729:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1730:Serpinb8 UTSW 1 107597527 missense probably benign
R1730:Serpinb8 UTSW 1 107598954 missense probably benign
R1730:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1739:Serpinb8 UTSW 1 107597527 missense probably benign
R1739:Serpinb8 UTSW 1 107598954 missense probably benign
R1739:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1762:Serpinb8 UTSW 1 107597527 missense probably benign
R1762:Serpinb8 UTSW 1 107598954 missense probably benign
R1762:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1783:Serpinb8 UTSW 1 107597527 missense probably benign
R1783:Serpinb8 UTSW 1 107598954 missense probably benign
R1783:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R1785:Serpinb8 UTSW 1 107597527 missense probably benign
R1785:Serpinb8 UTSW 1 107598954 missense probably benign
R1785:Serpinb8 UTSW 1 107607004 missense probably benign 0.02
R2120:Serpinb8 UTSW 1 107605887 missense probably damaging 1.00
R2146:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2148:Serpinb8 UTSW 1 107605927 missense probably benign 0.11
R2391:Serpinb8 UTSW 1 107607069 missense probably damaging 1.00
R2897:Serpinb8 UTSW 1 107607046 missense unknown
R2898:Serpinb8 UTSW 1 107607046 missense unknown
R3114:Serpinb8 UTSW 1 107607293 missense probably benign 0.09
R3697:Serpinb8 UTSW 1 107607146 nonsense probably null
R4783:Serpinb8 UTSW 1 107604742 missense probably benign 0.05
R5225:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R5412:Serpinb8 UTSW 1 107605886 missense probably benign 0.39
R5525:Serpinb8 UTSW 1 107607293 missense probably damaging 0.99
R5554:Serpinb8 UTSW 1 107598975 missense probably benign 0.01
R5891:Serpinb8 UTSW 1 107605845 missense probably damaging 0.98
R6594:Serpinb8 UTSW 1 107597471 start codon destroyed probably null 1.00
R6681:Serpinb8 UTSW 1 107597591 missense probably damaging 1.00
R7127:Serpinb8 UTSW 1 107597470 start codon destroyed probably null 1.00
R7151:Serpinb8 UTSW 1 107605797 missense probably damaging 1.00
R7716:Serpinb8 UTSW 1 107604708 nonsense probably null
R7807:Serpinb8 UTSW 1 107604727 missense probably damaging 1.00
R7822:Serpinb8 UTSW 1 107606993 nonsense probably null
X0018:Serpinb8 UTSW 1 107597597 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAGAATGTGCCCGTGTCC -3'
(R):5'- CAGAGTCCCCTGTATCATTTTGG -3'

Sequencing Primer
(F):5'- AAGGTTGCCCACAAGTGCTTTG -3'
(R):5'- GATGATCTTGAATGTGTGACCTACC -3'
Posted On2019-06-26