Incidental Mutation 'R7300:Ttc17'
ID566909
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Nametetratricopeptide repeat domain 17
SynonymsD2Bwg1005e, 9130020K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location94300767-94406689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94375134 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 289 (L289Q)
Ref Sequence ENSEMBL: ENSMUSP00000106869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]
Predicted Effect probably damaging
Transcript: ENSMUST00000094801
AA Change: L289Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_1 113 271 7.26e-16 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 3e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111237
AA Change: L289Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111238
AA Change: L289Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: L289Q

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94323083 splice site probably benign
IGL00870:Ttc17 APN 2 94371733 splice site probably null
IGL01120:Ttc17 APN 2 94371796 missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94332832 nonsense probably null
IGL01895:Ttc17 APN 2 94375146 missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94330667 missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94377710 missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94342661 missense probably benign
IGL02456:Ttc17 APN 2 94362785 splice site probably benign
IGL02475:Ttc17 APN 2 94364376 missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94375221 missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94386105 missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0443:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0511:Ttc17 UTSW 2 94323120 missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94332803 missense probably benign 0.08
R1980:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1981:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1987:Ttc17 UTSW 2 94364345 missense probably benign
R2064:Ttc17 UTSW 2 94366547 missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94301794 missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94366642 missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94376074 nonsense probably null
R3719:Ttc17 UTSW 2 94364327 missense probably benign 0.27
R3852:Ttc17 UTSW 2 94369413 missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94376146 splice site probably benign
R4411:Ttc17 UTSW 2 94342753 missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94366571 missense probably benign 0.02
R4660:Ttc17 UTSW 2 94364429 missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94371768 missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94332891 missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94364610 missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94366635 missense probably benign 0.01
R4870:Ttc17 UTSW 2 94366609 missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5386:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94303560 missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94377682 missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94362521 missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94378848 missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94358755 missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94303546 missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94386102 missense probably benign 0.02
R7204:Ttc17 UTSW 2 94362428 missense possibly damaging 0.95
R7446:Ttc17 UTSW 2 94375150 missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94366544 missense probably benign 0.06
R7912:Ttc17 UTSW 2 94378821 missense probably damaging 1.00
R7993:Ttc17 UTSW 2 94378821 missense probably damaging 1.00
X0013:Ttc17 UTSW 2 94330670 missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94324516 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTCTGTTCAAAAGCTCAGAGTG -3'
(R):5'- CACTTGTAACTGTGAAGTTGAGGG -3'

Sequencing Primer
(F):5'- GTTCAAAAGCTCAGAGTGTTATGAC -3'
(R):5'- CTGTGAAGTTGAGGGAAGATGATC -3'
Posted On2019-06-26