Incidental Mutation 'R7300:Spag4'
ID566913
Institutional Source Beutler Lab
Gene Symbol Spag4
Ensembl Gene ENSMUSG00000038180
Gene Namesperm associated antigen 4
Synonyms1700041K21Rik, Sun4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location156065175-156070617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156065621 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 87 (H87L)
Ref Sequence ENSEMBL: ENSMUSP00000036484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038860] [ENSMUST00000137966] [ENSMUST00000138178]
Predicted Effect probably benign
Transcript: ENSMUST00000038860
AA Change: H87L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036484
Gene: ENSMUSG00000038180
AA Change: H87L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 37 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 214 222 N/A INTRINSIC
Pfam:Sad1_UNC 293 426 1.9e-44 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000137966
SMART Domains Protein: ENSMUSP00000118715
Gene: ENSMUSG00000038180

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138178
AA Change: H62L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian sperm flagellum contains two cytoskeletal structures associated with the axoneme: the outer dense fibers surrounding the axoneme in the midpiece and principal piece and the fibrous sheath surrounding the outer dense fibers in the principal piece of the tail. Defects in these structures are associated with abnormal tail morphology, reduced sperm motility, and infertility. In the rat, the protein encoded by this gene associates with an outer dense fiber protein via a leucine zipper motif and localizes to the microtubules of the manchette and axoneme during sperm tail development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show disrupted spermiogenesis, severe defects in sperm head formation, abnormal manchette morphology, globozoospermia, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Spag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Spag4 APN 2 156069332 missense possibly damaging 0.88
IGL01843:Spag4 APN 2 156068497 missense probably benign 0.04
IGL02200:Spag4 APN 2 156066597 missense probably benign 0.14
IGL02506:Spag4 APN 2 156069222 missense probably damaging 1.00
IGL02570:Spag4 APN 2 156068444 missense possibly damaging 0.60
IGL03302:Spag4 APN 2 156068420 missense probably damaging 0.97
R0127:Spag4 UTSW 2 156068042 missense probably damaging 0.99
R0314:Spag4 UTSW 2 156067309 unclassified probably benign
R0441:Spag4 UTSW 2 156067979 missense probably damaging 1.00
R1699:Spag4 UTSW 2 156065422 missense probably damaging 1.00
R5270:Spag4 UTSW 2 156065933 intron probably benign
R5293:Spag4 UTSW 2 156066191 missense probably benign 0.07
R6092:Spag4 UTSW 2 156065776 intron probably benign
R7138:Spag4 UTSW 2 156066599 missense probably benign 0.00
R7898:Spag4 UTSW 2 156069324 missense probably damaging 1.00
R7981:Spag4 UTSW 2 156069324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGTTCCCACAGCGCGAC -3'
(R):5'- GTCTCAATCAGTGGAAACCGC -3'

Sequencing Primer
(F):5'- CTTCGGGGGACAGCAATG -3'
(R):5'- CCAGGCACAGGATTTCCTC -3'
Posted On2019-06-26