Incidental Mutation 'R7300:Adgrd1'
ID 566919
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7300 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 129097347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably null
Transcript: ENSMUST00000056617
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156437
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8780:Adgrd1 UTSW 5 129097074 start gained probably benign
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
R9528:Adgrd1 UTSW 5 129179676 missense probably benign 0.44
R9569:Adgrd1 UTSW 5 129179637 missense possibly damaging 0.90
R9626:Adgrd1 UTSW 5 129198657 missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGAAGGATCTTCCAGCATTCC -3'
(R):5'- GGACAGAGACCAGCTTTCTCAG -3'

Sequencing Primer
(F):5'- AGCATTCCCTTGCAGCTGG -3'
(R):5'- TTCTCAGCAGCAGCCCGAAG -3'
Posted On 2019-06-26