Incidental Mutation 'R7300:BC024978'
ID566922
Institutional Source Beutler Lab
Gene Symbol BC024978
Ensembl Gene ENSMUSG00000078786
Gene NamecDNA sequence BC024978
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27195781-27210186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27201123 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 176 (A176T)
Ref Sequence ENSEMBL: ENSMUSP00000104016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080356] [ENSMUST00000108379] [ENSMUST00000122202] [ENSMUST00000179391]
Predicted Effect probably benign
Transcript: ENSMUST00000080356
SMART Domains Protein: ENSMUSP00000079228
Gene: ENSMUSG00000061479

DomainStartEndE-ValueType
RRM 17 91 2.3e-14 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
RRM 214 283 6.31e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108379
AA Change: A176T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104016
Gene: ENSMUSG00000078786
AA Change: A176T

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122202
SMART Domains Protein: ENSMUSP00000113678
Gene: ENSMUSG00000061479

DomainStartEndE-ValueType
RRM 17 91 2.3e-14 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 125 156 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
RRM 214 283 6.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123108
Predicted Effect probably damaging
Transcript: ENSMUST00000155931
AA Change: A139T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123290
Gene: ENSMUSG00000078786
AA Change: A139T

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179391
AA Change: A176T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137189
Gene: ENSMUSG00000078786
AA Change: A176T

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in BC024978
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02654:BC024978 APN 7 27203873 missense probably damaging 0.97
IGL03092:BC024978 APN 7 27201136 missense probably damaging 1.00
IGL03184:BC024978 APN 7 27197007 utr 5 prime probably benign
IGL03348:BC024978 APN 7 27197120 unclassified probably null
R0245:BC024978 UTSW 7 27200603 missense possibly damaging 0.92
R0650:BC024978 UTSW 7 27202647 missense probably damaging 1.00
R1522:BC024978 UTSW 7 27202680 missense probably damaging 1.00
R4731:BC024978 UTSW 7 27201043 missense probably damaging 1.00
R4732:BC024978 UTSW 7 27201043 missense probably damaging 1.00
R4733:BC024978 UTSW 7 27201043 missense probably damaging 1.00
R5502:BC024978 UTSW 7 27197117 missense possibly damaging 0.90
R6672:BC024978 UTSW 7 27204064 intron probably benign
R7190:BC024978 UTSW 7 27201123 missense probably damaging 1.00
R7191:BC024978 UTSW 7 27201123 missense probably damaging 1.00
R7299:BC024978 UTSW 7 27201123 missense probably damaging 1.00
X0003:BC024978 UTSW 7 27202491 missense probably benign 0.07
X0024:BC024978 UTSW 7 27201091 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTAACTCCCACCTACCAGC -3'
(R):5'- AGGCAGTCTGGATTGACGTG -3'

Sequencing Primer
(F):5'- GAGGCAAGTCATACTTTGCCC -3'
(R):5'- CTGGATTGACGTGTCCTGGTAAC -3'
Posted On2019-06-26