Mutagenetix > Incidental Mutations

Incidental Mutation 'R7300:Large1'

566927

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R7300 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 72837596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 514 (L514R)

Ref Sequence

ENSEMBL: ENSMUSP00000004497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably damaging
Transcript: ENSMUST00000004497
AA Change: L514R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: L514R

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119826
AA Change: L514R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: L514R

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000212459
AA Change: L514R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

94% (45/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrd1	T	C	5: 129,097,347		probably null	Het
Atr	T	C	9: 95,865,370	I235T	probably benign	Het
BC024978	G	A	7: 27,201,123	A176T	probably damaging	Het
Bpifb5	A	G	2: 154,228,146	E172G	possibly damaging	Het
Btbd2	A	T	10: 80,644,266	I420N	probably damaging	Het
C330027C09Rik	A	G	16: 49,013,854	K631E	probably damaging	Het
Ccdc141	G	A	2: 77,014,694	T1343I	probably benign	Het
Cd59b	A	T	2: 104,084,450	K64N	possibly damaging	Het
Cd63	A	G	10: 128,912,165	N144S	probably benign	Het
Col4a4	C	T	1: 82,486,640	R989Q	unknown	Het
Cyp4a31	A	G	4: 115,570,271	T225A	probably benign	Het
Dnah1	T	G	14: 31,269,841	E3068A	probably benign	Het
Fpgt	C	T	3: 155,086,975	V472I	probably damaging	Het
Gm3147	A	T	5: 94,612,796	D340E	probably benign	Het
Gm4779	TCGGGGCCGGGGCCGGGGCCG	TCGGGGCCGGGGCCGGGGCCGGGGCCG	X: 101,794,171		probably benign	Het
Homer3	T	C	8: 70,285,303	M1T	probably null	Het
Ighv1-4	T	C	12: 114,487,288	I67V	probably benign	Het
Il17ra	A	G	6: 120,482,102	D738G	probably benign	Het
Il2ra	A	G	2: 11,676,910	T109A	not run	Het
Itgb6	T	C	2: 60,605,306	D700G	probably benign	Het
Krt31	T	C	11: 100,047,786	E327G	probably damaging	Het
Map3k8	C	T	18: 4,349,076	V81M	probably damaging	Het
Mstn	T	C	1: 53,064,080	S192P	probably benign	Het
Olfml3	T	C	3: 103,735,860	K402E	probably damaging	Het
Olfr1061	T	C	2: 86,413,986	E22G	probably null	Het
Olfr135	A	C	17: 38,208,697	T151P	possibly damaging	Het
Olfr1386	C	T	11: 49,470,646	T165I	probably benign	Het
Olfr556	A	G	7: 102,670,210	S97G	probably benign	Het
Olfr60	A	T	7: 140,345,355	N211K	probably damaging	Het
Olfr829	T	C	9: 18,857,234	I194T	not run	Het
Pde4a	T	C	9: 21,206,322	S627P	probably damaging	Het
Pdxdc1	A	G	16: 13,879,510	I102T	probably damaging	Het
Phldb2	A	G	16: 45,825,562	S174P	probably damaging	Het
Pla2g4e	C	T	2: 120,191,199	V143I	probably damaging	Het
Pou4f2	C	T	8: 78,436,106		probably null	Het
Ppl	C	T	16: 5,102,371	V387M	possibly damaging	Het
Rarg	A	T	15: 102,252,417		probably null	Het
Ryr1	T	C	7: 29,059,511	Y3414C	probably damaging	Het
Serpinb8	T	A	1: 107,607,323	*375K	probably null	Het
Sim1	C	T	10: 50,909,518	H228Y	probably benign	Het
Spag4	A	T	2: 156,065,621	H87L	probably benign	Het
Ttc17	A	T	2: 94,375,134	L289Q	probably damaging	Het
Ubac2	T	C	14: 121,905,174	L28P	probably damaging	Het
Vmn2r31	C	A	7: 7,384,776	A599S	possibly damaging	Het
Vps13c	T	C	9: 67,940,544	V2196A	probably benign	Het
Zswim5	A	T	4: 116,975,905	I612F	probably damaging	Het
Zzef1	T	A	11: 72,875,004	H1452Q	probably benign	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7493:Large1	UTSW	8	72823715	missense	probably benign	0.23
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTACTCATAGAGCCCATACATAGG -3'
(R):5'- TGCTTTACTGATGAGGAACGGAG -3'

Sequencing Primer
(F):5'- CCATACATAGGCAGGAAGTCAATGTC -3'
(R):5'- CTGATGAGGAACGGAGTCATATTTAG -3'

Posted On

2019-06-26