Incidental Mutation 'R7300:Btbd2'
ID566933
Institutional Source Beutler Lab
Gene Symbol Btbd2
Ensembl Gene ENSMUSG00000003344
Gene NameBTB (POZ) domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80642617-80657071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80644266 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 420 (I420N)
Ref Sequence ENSEMBL: ENSMUSP00000003434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000079773] [ENSMUST00000085435] [ENSMUST00000126980]
Predicted Effect probably damaging
Transcript: ENSMUST00000003434
AA Change: I420N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344
AA Change: I420N

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079773
SMART Domains Protein: ENSMUSP00000078706
Gene: ENSMUSG00000003345

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase 126 329 2e-19 PFAM
Pfam:Pkinase_Tyr 128 329 6.2e-10 PFAM
Pfam:CK1gamma_C 382 412 4e-11 PFAM
low complexity region 425 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085435
SMART Domains Protein: ENSMUSP00000082560
Gene: ENSMUSG00000003345

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 308 1.3e-14 PFAM
Pfam:Pkinase 46 313 7.6e-35 PFAM
Pfam:CK1gamma_C 354 385 1.2e-11 PFAM
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126980
AA Change: I405N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344
AA Change: I405N

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131876
SMART Domains Protein: ENSMUSP00000120780
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
BTB 2 85 4.38e-12 SMART
BACK 90 199 1.21e-13 SMART
PDB:3NO8|B 234 256 1e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000220163
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Btbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
brachio UTSW 10 80645531 missense probably damaging 1.00
R0245:Btbd2 UTSW 10 80647806 missense probably damaging 1.00
R1794:Btbd2 UTSW 10 80643913 missense probably damaging 1.00
R1960:Btbd2 UTSW 10 80644705 missense probably benign 0.06
R4827:Btbd2 UTSW 10 80646389 missense probably damaging 1.00
R5197:Btbd2 UTSW 10 80646419 missense probably damaging 0.98
R5372:Btbd2 UTSW 10 80648641 missense probably damaging 0.99
R6108:Btbd2 UTSW 10 80645531 missense probably damaging 1.00
R6316:Btbd2 UTSW 10 80644778 missense probably damaging 0.98
R6355:Btbd2 UTSW 10 80645349 missense possibly damaging 0.81
R6872:Btbd2 UTSW 10 80644332 missense probably damaging 0.99
R7016:Btbd2 UTSW 10 80648615 missense probably damaging 1.00
R7524:Btbd2 UTSW 10 80646444 missense probably damaging 0.97
R7617:Btbd2 UTSW 10 80646392 missense probably damaging 1.00
R7756:Btbd2 UTSW 10 80648606 missense probably benign 0.05
R7762:Btbd2 UTSW 10 80643556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAAGATGGGTATGGCGG -3'
(R):5'- AGGCTTTGGTCCAGAATGG -3'

Sequencing Primer
(F):5'- TGCCTTCGTATGGTATGC -3'
(R):5'- AATGGGCAATGTGACGTCCC -3'
Posted On2019-06-26