Incidental Mutation 'R7300:Cd63'
ID566934
Institutional Source Beutler Lab
Gene Symbol Cd63
Ensembl Gene ENSMUSG00000025351
Gene NameCD63 antigen
SynonymsME491, Tspan30
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128900989-128912822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128912165 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 144 (N144S)
Ref Sequence ENSEMBL: ENSMUSP00000026407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026406] [ENSMUST00000026407] [ENSMUST00000105229] [ENSMUST00000137747] [ENSMUST00000149961] [ENSMUST00000219317] [ENSMUST00000220308]
Predicted Effect probably benign
Transcript: ENSMUST00000026406
SMART Domains Protein: ENSMUSP00000026406
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 194 3.6e-23 PFAM
Pfam:adh_short_C2 35 230 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026407
AA Change: N144S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026407
Gene: ENSMUSG00000025351
AA Change: N144S

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 231 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105229
AA Change: N144S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100862
Gene: ENSMUSG00000025351
AA Change: N144S

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 231 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137747
SMART Domains Protein: ENSMUSP00000116558
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
PDB:2JAP|D 1 80 6e-11 PDB
SCOP:d1hu4a_ 1 151 1e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149961
SMART Domains Protein: ENSMUSP00000123183
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
Pfam:adh_short 2 124 4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219317
AA Change: N144S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000220308
AA Change: N144S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The encoded protein is a cell surface glycoprotein that is known to complex with integrins. It may function as a blood platelet activation marker. Deficiency of this protein is associated with Hermansky-Pudlak syndrome. Also this gene has been associated with tumor progression. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice are viable and fertile without gross morphological abnormalities, but show an altered water balance, indicated by an increased urinary flow, water intake, reduced urine osmolality, and a higher fecal water content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Cd63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02259:Cd63 APN 10 128911974 missense probably benign 0.01
IGL02683:Cd63 APN 10 128910430 missense probably damaging 1.00
R5212:Cd63 UTSW 10 128911853 missense probably damaging 1.00
R5775:Cd63 UTSW 10 128910430 missense probably damaging 0.99
R5888:Cd63 UTSW 10 128912291 unclassified probably null
R6180:Cd63 UTSW 10 128912064 critical splice donor site probably null
R6526:Cd63 UTSW 10 128911489 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCGGAAGTCTGTTCTCTAC -3'
(R):5'- ACTCTGATCCCGTAAGCATCTC -3'

Sequencing Primer
(F):5'- ACTTCTCTGCTCTTAGGTGAAGTCAG -3'
(R):5'- GATCCCGTAAGCATCTCCTGTC -3'
Posted On2019-06-26