Incidental Mutation 'R7300:Olfr1386'
ID566935
Institutional Source Beutler Lab
Gene Symbol Olfr1386
Ensembl Gene ENSMUSG00000108167
Gene Nameolfactory receptor 1386
SynonymsGA_x6K02T2QP88-5964781-5963852, MOR256-50
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49465046-49471715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49470646 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 165 (T165I)
Ref Sequence ENSEMBL: ENSMUSP00000145320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071905] [ENSMUST00000204518] [ENSMUST00000213674]
Predicted Effect probably benign
Transcript: ENSMUST00000071905
AA Change: T165I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000071801
Gene: ENSMUSG00000108167
AA Change: T165I

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204518
AA Change: T165I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000145320
Gene: ENSMUSG00000108167
AA Change: T165I

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.2e-5 PFAM
Pfam:7tm_1 41 289 7.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213674
AA Change: T165I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Krt31 T C 11: 100,047,786 E327G probably damaging Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Olfr1386
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Olfr1386 APN 11 49471053 missense probably benign 0.00
IGL02698:Olfr1386 APN 11 49470863 missense probably benign 0.02
IGL02727:Olfr1386 APN 11 49471066 missense probably benign 0.04
R0826:Olfr1386 UTSW 11 49470331 missense probably damaging 1.00
R1512:Olfr1386 UTSW 11 49470459 missense probably benign 0.00
R1822:Olfr1386 UTSW 11 49470968 missense probably benign 0.03
R1942:Olfr1386 UTSW 11 49470154 start codon destroyed probably null 0.98
R2282:Olfr1386 UTSW 11 49470643 missense probably damaging 0.96
R4646:Olfr1386 UTSW 11 49470624 missense probably benign 0.00
R4762:Olfr1386 UTSW 11 49470285 missense probably damaging 1.00
R4892:Olfr1386 UTSW 11 49470216 missense probably benign 0.00
R4968:Olfr1386 UTSW 11 49470531 missense probably damaging 1.00
R6882:Olfr1386 UTSW 11 49470463 missense probably benign
R7107:Olfr1386 UTSW 11 49470434 nonsense probably null
R7308:Olfr1386 UTSW 11 49469927 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GATCCACTGAGTGTGTGCTC -3'
(R):5'- CCACATGTCCCAAAAGCTTTTCTG -3'

Sequencing Primer
(F):5'- CCTGGTAGTGATGGCTTTTGACC -3'
(R):5'- AAAAGCTTTTCTGCGTCCAG -3'
Posted On2019-06-26