Incidental Mutation 'R7300:Krt31'
ID566937
Institutional Source Beutler Lab
Gene Symbol Krt31
Ensembl Gene ENSMUSG00000048981
Gene Namekeratin 31
SynonymsHa1, Kha1, Krt1-1, MKHA-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7300 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100046646-100050551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100047786 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 327 (E327G)
Ref Sequence ENSEMBL: ENSMUSP00000007318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007318]
Predicted Effect probably damaging
Transcript: ENSMUST00000007318
AA Change: E327G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007318
Gene: ENSMUSG00000048981
AA Change: E327G

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 2.14e-153 SMART
low complexity region 384 411 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T C 5: 129,097,347 probably null Het
Atr T C 9: 95,865,370 I235T probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Bpifb5 A G 2: 154,228,146 E172G possibly damaging Het
Btbd2 A T 10: 80,644,266 I420N probably damaging Het
C330027C09Rik A G 16: 49,013,854 K631E probably damaging Het
Ccdc141 G A 2: 77,014,694 T1343I probably benign Het
Cd59b A T 2: 104,084,450 K64N possibly damaging Het
Cd63 A G 10: 128,912,165 N144S probably benign Het
Col4a4 C T 1: 82,486,640 R989Q unknown Het
Cyp4a31 A G 4: 115,570,271 T225A probably benign Het
Dnah1 T G 14: 31,269,841 E3068A probably benign Het
Fpgt C T 3: 155,086,975 V472I probably damaging Het
Gm3147 A T 5: 94,612,796 D340E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Homer3 T C 8: 70,285,303 M1T probably null Het
Ighv1-4 T C 12: 114,487,288 I67V probably benign Het
Il17ra A G 6: 120,482,102 D738G probably benign Het
Il2ra A G 2: 11,676,910 T109A not run Het
Itgb6 T C 2: 60,605,306 D700G probably benign Het
Large1 A C 8: 72,837,596 L514R probably damaging Het
Map3k8 C T 18: 4,349,076 V81M probably damaging Het
Mstn T C 1: 53,064,080 S192P probably benign Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1061 T C 2: 86,413,986 E22G probably null Het
Olfr135 A C 17: 38,208,697 T151P possibly damaging Het
Olfr1386 C T 11: 49,470,646 T165I probably benign Het
Olfr556 A G 7: 102,670,210 S97G probably benign Het
Olfr60 A T 7: 140,345,355 N211K probably damaging Het
Olfr829 T C 9: 18,857,234 I194T not run Het
Pde4a T C 9: 21,206,322 S627P probably damaging Het
Pdxdc1 A G 16: 13,879,510 I102T probably damaging Het
Phldb2 A G 16: 45,825,562 S174P probably damaging Het
Pla2g4e C T 2: 120,191,199 V143I probably damaging Het
Pou4f2 C T 8: 78,436,106 probably null Het
Ppl C T 16: 5,102,371 V387M possibly damaging Het
Rarg A T 15: 102,252,417 probably null Het
Ryr1 T C 7: 29,059,511 Y3414C probably damaging Het
Serpinb8 T A 1: 107,607,323 *375K probably null Het
Sim1 C T 10: 50,909,518 H228Y probably benign Het
Spag4 A T 2: 156,065,621 H87L probably benign Het
Ttc17 A T 2: 94,375,134 L289Q probably damaging Het
Ubac2 T C 14: 121,905,174 L28P probably damaging Het
Vmn2r31 C A 7: 7,384,776 A599S possibly damaging Het
Vps13c T C 9: 67,940,544 V2196A probably benign Het
Zswim5 A T 4: 116,975,905 I612F probably damaging Het
Zzef1 T A 11: 72,875,004 H1452Q probably benign Het
Other mutations in Krt31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Krt31 APN 11 100048396 missense probably damaging 1.00
IGL02433:Krt31 APN 11 100048395 missense probably damaging 1.00
R0393:Krt31 UTSW 11 100050253 missense probably damaging 1.00
R0667:Krt31 UTSW 11 100048125 missense probably benign 0.02
R1224:Krt31 UTSW 11 100049864 critical splice donor site probably null
R1544:Krt31 UTSW 11 100047873 missense possibly damaging 0.48
R1891:Krt31 UTSW 11 100047808 missense probably damaging 0.98
R1940:Krt31 UTSW 11 100048243 missense probably benign 0.03
R1987:Krt31 UTSW 11 100049580 missense probably benign 0.00
R2761:Krt31 UTSW 11 100047865 missense probably benign 0.01
R2870:Krt31 UTSW 11 100047873 missense possibly damaging 0.82
R2870:Krt31 UTSW 11 100047873 missense possibly damaging 0.82
R3980:Krt31 UTSW 11 100048204 missense probably damaging 0.96
R4809:Krt31 UTSW 11 100049922 missense possibly damaging 0.89
R4822:Krt31 UTSW 11 100047784 missense possibly damaging 0.63
R4931:Krt31 UTSW 11 100050157 missense probably benign 0.05
R6146:Krt31 UTSW 11 100048230 missense probably benign 0.21
R6722:Krt31 UTSW 11 100048428 missense probably damaging 1.00
R6811:Krt31 UTSW 11 100048416 missense probably damaging 1.00
R6996:Krt31 UTSW 11 100047732 missense probably benign 0.19
R7548:Krt31 UTSW 11 100049520 missense probably damaging 0.98
X0028:Krt31 UTSW 11 100047708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCCATAGTATTTTCTAAGCTC -3'
(R):5'- TGGAAGTCATGCAGAAACCTTC -3'

Sequencing Primer
(F):5'- TCCTGATATAGGCAATCCCTGGG -3'
(R):5'- CTTCAGAGGGAACAGCTCTGTG -3'
Posted On2019-06-26