Mutagenetix > Incidental Mutations

Incidental Mutation 'R7301:Myo3a'

566952

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7301 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 22544466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000046329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm3	G	A	7: 119,777,085	S345N	possibly damaging	Het
Agk	A	T	6: 40,329,517	T7S	possibly damaging	Het
Ankrd26	T	C	6: 118,511,663	E1345G	possibly damaging	Het
Atp1a3	T	A	7: 24,990,515	Y493F	probably benign	Het
Atxn2l	G	T	7: 126,494,211	Y791*	probably null	Het
Cacng8	C	A	7: 3,415,421	T363K	probably benign	Het
Camkmt	A	G	17: 85,431,493	T216A	probably benign	Het
Cd2ap	G	A	17: 42,830,013	R212*	probably null	Het
Cnppd1	A	G	1: 75,136,424	L400P	probably damaging	Het
Csmd2	C	A	4: 128,528,262	D2797E		Het
Ddx24	A	G	12: 103,419,450	M298T	possibly damaging	Het
Dpyd	T	C	3: 118,899,284	V359A	possibly damaging	Het
Dscam	T	C	16: 97,056,532	T93A	probably benign	Het
Eif2b3	T	A	4: 117,052,822	S185T	probably benign	Het
Entpd2	T	A	2: 25,400,909	I475N	possibly damaging	Het
Ercc2	C	A	7: 19,394,135	Q715K	probably benign	Het
Fam122a	T	A	19: 24,477,124	H78L	probably benign	Het
Fam122a	T	A	19: 24,477,346	E4V	probably damaging	Het
Fam186b	T	C	15: 99,278,748	R754G	probably benign	Het
Fcgbp	T	A	7: 28,093,436	V955E	possibly damaging	Het
Frrs1	T	C	3: 116,895,563	V361A	possibly damaging	Het
Gabrr2	T	A	4: 33,095,284	M391K	probably benign	Het
Gm12394	T	C	4: 42,792,923	N403S	possibly damaging	Het
Gm3409	T	A	5: 146,539,547	D169E	probably benign	Het
Gm4779	TCGGGGCCGGGGCCGGGGCCG	TCGGGGCCGGGGCCGGGGCCGGGGCCG	X: 101,794,171		probably benign	Het
Greb1l	C	G	18: 10,544,970	Q1433E	probably damaging	Het
Hal	T	C	10: 93,492,561	V233A	probably benign	Het
Ighv1-58	A	T	12: 115,312,295	N74K	probably benign	Het
Il12rb1	A	G	8: 70,813,699	I229M	possibly damaging	Het
Il17rd	T	C	14: 27,076,391	I56T	possibly damaging	Het
Itpr1	T	C	6: 108,542,024	V2708A	possibly damaging	Het
Klhl38	G	A	15: 58,322,980	R118W	probably damaging	Het
Lmf2	C	A	15: 89,355,530		probably benign	Het
Lrrc3b	T	C	14: 15,357,934	Y224C	probably damaging	Het
Med1	A	C	11: 98,152,808	F599C	probably benign	Het
Mrgprb4	A	G	7: 48,198,758	S141P	probably damaging	Het
Mst1r	G	T	9: 107,914,790	A842S	possibly damaging	Het
Nos1	A	T	5: 117,867,905	D230V	possibly damaging	Het
Nppb	T	C	4: 147,986,323	S52P	probably benign	Het
Nqo1	A	G	8: 107,392,648	I99T	probably damaging	Het
Olfr346	T	A	2: 36,688,011	M3K	probably benign	Het
Olfr769	T	C	10: 129,111,699	H242R	probably damaging	Het
Pcdha3	G	A	18: 36,946,924	E240K	possibly damaging	Het
Plpp7	T	G	2: 32,096,055	F82V	probably benign	Het
Podxl	G	T	6: 31,524,436	P395T	probably damaging	Het
Prr5l	T	A	2: 101,717,286	D298V	probably damaging	Het
Rad9b	A	G	5: 122,352,614	V13A	possibly damaging	Het
Rasl2-9	A	G	7: 5,125,740	W64R	probably damaging	Het
Rilp	G	T	11: 75,510,116		probably benign	Het
Ripor2	T	C	13: 24,725,001	I1034T	possibly damaging	Het
Rtn4ip1	T	C	10: 43,936,020	Y338H	probably damaging	Het
Shisa5	G	T	9: 109,054,884		probably benign	Het
Slc27a4	C	T	2: 29,812,932	T591I	probably null	Het
Snx24	G	T	18: 53,340,172	V63F	probably damaging	Het
Sptbn1	A	T	11: 30,117,798	Y1805*	probably null	Het
Svep1	G	A	4: 58,046,587	Q3515*	probably null	Het
Synpo2	A	C	3: 123,114,053	M538R	probably benign	Het
Tfap2a	T	C	13: 40,721,308	K276E	probably damaging	Het
Tmem158	C	A	9: 123,260,301	S82I	probably damaging	Het
Tmtc3	G	T	10: 100,447,474	H740N	not run	Het
Top3a	A	T	11: 60,748,148	F559I	probably damaging	Het
Tysnd1	C	A	10: 61,696,549	P327T	possibly damaging	Het
Ulk4	T	A	9: 121,145,059	D969V	probably benign	Het
Vcan	T	A	13: 89,705,266	Y525F	probably benign	Het
Vmn1r127	A	G	7: 21,319,053	F270S	probably benign	Het
Vmn1r204	G	A	13: 22,556,805	S202N	probably damaging	Het
Vmn2r107	A	G	17: 20,345,616	I64M	probably benign	Het
Zfp280b	C	G	10: 76,038,703	Q139E	probably damaging	Het
Zfp322a	C	A	13: 23,357,143	G143V	probably damaging	Het
Zfp322a	C	T	13: 23,357,144	G143S	probably benign	Het
Zfyve26	A	T	12: 79,282,984	V476D	probably benign	Het
Zkscan6	A	T	11: 65,828,225	H357L	probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- TCATGTAAGCATTGAGGATGACAG -3'
(R):5'- CTGGTGAGGTTGTCAAATGC -3'

Sequencing Primer
(F):5'- GACAGTGACTGTTTATAATAACCACC -3'
(R):5'- ATGCTTTTCTTTATAGAAGCCTTGC -3'

Posted On

2019-06-26