Incidental Mutation 'R7301:Slc27a4'
ID566954
Institutional Source Beutler Lab
Gene Symbol Slc27a4
Ensembl Gene ENSMUSG00000059316
Gene Namesolute carrier family 27 (fatty acid transporter), member 4
SynonymsFATP4, fatty acid transport protein 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29802634-29817522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29812932 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 591 (T591I)
Ref Sequence ENSEMBL: ENSMUSP00000078971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080065]
Predicted Effect probably null
Transcript: ENSMUST00000080065
AA Change: T591I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078971
Gene: ENSMUSG00000059316
AA Change: T591I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:AMP-binding 80 512 1.2e-72 PFAM
Pfam:AMP-binding_C 520 595 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutant mice are not viable. While mice of one mutant line die during early development, mice of other mutant lines die at birth exhibiting abnormal skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Slc27a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc27a4 APN 2 29804302 missense probably benign 0.03
IGL01982:Slc27a4 APN 2 29812615 missense probably damaging 1.00
IGL02160:Slc27a4 APN 2 29805962 missense probably benign 0.04
IGL02290:Slc27a4 APN 2 29815729 missense probably damaging 1.00
IGL02382:Slc27a4 APN 2 29809843 missense probably damaging 1.00
IGL02738:Slc27a4 APN 2 29811226 missense probably benign 0.15
R0470:Slc27a4 UTSW 2 29804185 missense probably benign 0.10
R0688:Slc27a4 UTSW 2 29812615 missense probably damaging 1.00
R0847:Slc27a4 UTSW 2 29811249 missense probably benign 0.20
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1584:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1793:Slc27a4 UTSW 2 29805721 missense probably benign 0.00
R1804:Slc27a4 UTSW 2 29811267 missense probably benign 0.01
R2056:Slc27a4 UTSW 2 29810941 missense probably damaging 0.99
R4901:Slc27a4 UTSW 2 29812636 missense probably damaging 1.00
R5601:Slc27a4 UTSW 2 29805660 missense probably benign 0.30
R5663:Slc27a4 UTSW 2 29812370 missense probably damaging 1.00
R5934:Slc27a4 UTSW 2 29811660 missense probably damaging 0.96
R6196:Slc27a4 UTSW 2 29805750 missense probably benign 0.00
R6643:Slc27a4 UTSW 2 29812848 missense probably benign 0.01
R7033:Slc27a4 UTSW 2 29804271 missense possibly damaging 0.94
R7176:Slc27a4 UTSW 2 29811226 missense probably benign 0.15
R7179:Slc27a4 UTSW 2 29815652 nonsense probably null
R7192:Slc27a4 UTSW 2 29805929 missense probably damaging 1.00
R7500:Slc27a4 UTSW 2 29812705 missense probably damaging 0.99
R7810:Slc27a4 UTSW 2 29805710 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GATGGTGAGCATGTCCGAAC -3'
(R):5'- GTATGGCAGCCATAGAATAGTCC -3'

Sequencing Primer
(F):5'- TGAGCATGTCCGAACATTGC -3'
(R):5'- TCCCCATTCTAAGAGATGGTGAGC -3'
Posted On2019-06-26