Incidental Mutation 'R7301:Cacng8'
ID566974
Institutional Source Beutler Lab
Gene Symbol Cacng8
Ensembl Gene ENSMUSG00000053395
Gene Namecalcium channel, voltage-dependent, gamma subunit 8
SynonymsTARP gamma 8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7301 (G1)
Quality Score99.0078
Status Not validated
Chromosome7
Chromosomal Location3390683-3415648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3415421 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 363 (T363K)
Ref Sequence ENSEMBL: ENSMUSP00000090005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092351] [ENSMUST00000182222]
Predicted Effect probably benign
Transcript: ENSMUST00000092351
AA Change: T363K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090005
Gene: ENSMUSG00000053395
AA Change: T363K

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 17 222 8.1e-41 PFAM
Pfam:Claudin_2 29 223 6.2e-22 PFAM
low complexity region 244 258 N/A INTRINSIC
low complexity region 261 287 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 316 360 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182222
AA Change: T363K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138618
Gene: ENSMUSG00000053395
AA Change: T363K

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 17 222 8.1e-41 PFAM
Pfam:Claudin_2 29 223 6.8e-24 PFAM
low complexity region 244 258 N/A INTRINSIC
low complexity region 261 287 N/A INTRINSIC
low complexity region 291 298 N/A INTRINSIC
low complexity region 316 360 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type II TARP and a calcium channel gamma subunit. The mRNA for this gene is believed to initiate translation from a non-AUG (CUG) start codon. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted null mutations of this gene result in altered hippocampal AMPA receptor number, distribution and synaptic plasticity. Mice homozygous for one knock-out allele exhibit significantly impaired long term potentiation in hippocampal CA1 synapses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Cacng8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0865:Cacng8 UTSW 7 3412109 missense possibly damaging 0.83
R1387:Cacng8 UTSW 7 3415156 missense possibly damaging 0.73
R1892:Cacng8 UTSW 7 3415052 missense possibly damaging 0.95
R3847:Cacng8 UTSW 7 3394474 missense probably damaging 1.00
R4763:Cacng8 UTSW 7 3414992 missense probably damaging 0.99
R4882:Cacng8 UTSW 7 3412153 missense probably damaging 1.00
R5085:Cacng8 UTSW 7 3415580 missense possibly damaging 0.96
R5497:Cacng8 UTSW 7 3415553 missense probably benign
R7034:Cacng8 UTSW 7 3415303 missense probably benign 0.00
R7036:Cacng8 UTSW 7 3415303 missense probably benign 0.00
R7469:Cacng8 UTSW 7 3415105 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCCATGTACACGCTCAGC -3'
(R):5'- AAGGGTCCCTGTTTCGGAG -3'

Sequencing Primer
(F):5'- CCGCGACCCGTCCAAGG -3'
(R):5'- TCCCTGTTTCGGAGCGTGAC -3'
Posted On2019-06-26