Incidental Mutation 'R7301:Ercc2'
ID566976
Institutional Source Beutler Lab
Gene Symbol Ercc2
Ensembl Gene ENSMUSG00000030400
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 2
SynonymsXPD, Ercc-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19382010-19395694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19394135 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 715 (Q715K)
Ref Sequence ENSEMBL: ENSMUSP00000054380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047170] [ENSMUST00000062831] [ENSMUST00000108457] [ENSMUST00000108458] [ENSMUST00000108459] [ENSMUST00000108460] [ENSMUST00000108461]
Predicted Effect probably benign
Transcript: ENSMUST00000047170
SMART Domains Protein: ENSMUSP00000038091
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062831
AA Change: Q715K

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000054380
Gene: ENSMUSG00000030400
AA Change: Q715K

DomainStartEndE-ValueType
DEXDc 8 280 1.62e-144 SMART
Blast:DEXDc2 340 369 3e-10 BLAST
Blast:DEXDc 412 467 9e-27 BLAST
HELICc 542 686 1.32e-76 SMART
low complexity region 733 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108457
SMART Domains Protein: ENSMUSP00000104097
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.7e-57 PFAM
Pfam:TPR_10 206 247 3.2e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108458
SMART Domains Protein: ENSMUSP00000104098
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
Pfam:Rab5-bind 79 248 1.1e-56 PFAM
Pfam:TPR_10 206 247 1.7e-6 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108459
SMART Domains Protein: ENSMUSP00000104099
Gene: ENSMUSG00000040714

DomainStartEndE-ValueType
coiled coil region 88 150 N/A INTRINSIC
low complexity region 157 173 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
Pfam:TPR_10 206 247 5.6e-7 PFAM
TPR 249 282 1.66e-1 SMART
TPR 291 324 1.89e-5 SMART
TPR 333 366 1.66e-1 SMART
TPR 375 408 2.55e-2 SMART
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108460
AA Change: Q694K

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104100
Gene: ENSMUSG00000030400
AA Change: Q694K

DomainStartEndE-ValueType
DEXDc 8 259 1.7e-120 SMART
Blast:DEXDc2 319 348 3e-10 BLAST
Blast:DEXDc 391 446 8e-27 BLAST
HELICc 521 665 1.32e-76 SMART
low complexity region 712 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108461
AA Change: Q463K

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104101
Gene: ENSMUSG00000030400
AA Change: Q463K

DomainStartEndE-ValueType
Pfam:DUF1227 16 161 4.5e-60 PFAM
Blast:HELICc2 193 262 1e-40 BLAST
HELICc 290 434 1.32e-76 SMART
low complexity region 481 499 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117840
Gene: ENSMUSG00000030400
AA Change: Q638K

DomainStartEndE-ValueType
DEXDc 10 204 1.14e-71 SMART
Blast:DEXDc2 264 293 2e-10 BLAST
Blast:DEXDc 336 391 5e-27 BLAST
HELICc 466 610 1.32e-76 SMART
low complexity region 657 675 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleotide excision repair pathway is a mechanism to repair damage to DNA. The protein encoded by this gene is involved in transcription-coupled nucleotide excision repair and is an integral member of the basal transcription factor BTF2/TFIIH complex. The gene product has ATP-dependent DNA helicase activity and belongs to the RAD3/XPD subfamily of helicases. Defects in this gene can result in three different disorders, the cancer-prone syndrome xeroderma pigmentosum complementation group D, trichothiodystrophy, and Cockayne syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die prior to implantation. Homozygotes for a targeted missense mutation exhibit brittle and greying hair, cachexia, infertility, osteosclerosis, osteoporosis, reduced lifespan, UV sensitivity, and skin defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Ercc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ercc2 APN 7 19390417 missense probably benign 0.03
IGL01767:Ercc2 APN 7 19390421 missense probably damaging 1.00
IGL01810:Ercc2 APN 7 19393449 missense probably damaging 1.00
IGL02485:Ercc2 APN 7 19394045 missense possibly damaging 0.83
IGL02891:Ercc2 APN 7 19393286 missense probably damaging 1.00
IGL03010:Ercc2 APN 7 19391566 missense possibly damaging 0.89
R0304:Ercc2 UTSW 7 19386708 missense possibly damaging 0.75
R0512:Ercc2 UTSW 7 19393887 missense probably damaging 0.99
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1467:Ercc2 UTSW 7 19385886 missense probably benign 0.05
R1600:Ercc2 UTSW 7 19385941 missense probably benign 0.00
R1636:Ercc2 UTSW 7 19387124 missense possibly damaging 0.94
R2156:Ercc2 UTSW 7 19386792 missense possibly damaging 0.95
R2446:Ercc2 UTSW 7 19386944 missense probably damaging 0.97
R4458:Ercc2 UTSW 7 19393846 missense probably damaging 1.00
R4869:Ercc2 UTSW 7 19386807 missense probably damaging 1.00
R5861:Ercc2 UTSW 7 19394141 missense possibly damaging 0.91
R6960:Ercc2 UTSW 7 19393690 missense probably damaging 0.98
R7354:Ercc2 UTSW 7 19393654 missense possibly damaging 0.91
Z1176:Ercc2 UTSW 7 19385668 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGGTCTTTGCTGACAAGGTG -3'
(R):5'- TAAAGGGCAGGAGTCAGCTCAC -3'

Sequencing Primer
(F):5'- AGTCCAGGTAGCCCGACTTC -3'
(R):5'- AGGAGTCAGCTCACACGGG -3'
Posted On2019-06-26