Incidental Mutation 'R7301:Atp1a3'
ID566978
Institutional Source Beutler Lab
Gene Symbol Atp1a3
Ensembl Gene ENSMUSG00000040907
Gene NameATPase, Na+/K+ transporting, alpha 3 polypeptide
SynonymsAtpa-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24978167-25005958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24990515 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 493 (Y493F)
Ref Sequence ENSEMBL: ENSMUSP00000079691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684]
Predicted Effect probably benign
Transcript: ENSMUST00000080882
AA Change: Y493F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907
AA Change: Y493F

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 125 356 6.3e-64 PFAM
Pfam:Hydrolase 360 719 2.6e-32 PFAM
Pfam:HAD 363 716 4.7e-18 PFAM
Pfam:Hydrolase_like2 416 511 5.7e-26 PFAM
Pfam:Cation_ATPase_C 789 998 3.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102858
AA Change: Y493F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907
AA Change: Y493F

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 124 355 4.6e-60 PFAM
Pfam:Hydrolase 360 719 5.7e-20 PFAM
Pfam:HAD 363 716 4.5e-19 PFAM
Pfam:Cation_ATPase 416 511 5.1e-25 PFAM
Pfam:Cation_ATPase_C 789 998 1.4e-46 PFAM
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196684
AA Change: Y506F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907
AA Change: Y506F

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Cation_ATPase_N 45 119 1.9e-26 SMART
Pfam:E1-E2_ATPase 137 368 4e-58 PFAM
Pfam:Hydrolase 373 732 3.8e-18 PFAM
Pfam:HAD 376 729 3.8e-17 PFAM
Pfam:Cation_ATPase 429 524 5.2e-23 PFAM
Pfam:Cation_ATPase_C 802 1011 2.5e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display neonatal lethality. Heterozygous mice display hyperactivity, increased activity in responses to methamphetamine, and impaired spatial learning. Mice heterozygous for an ENU mutation exhibit convulsive and vestibular stress induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Atp1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Atp1a3 APN 7 24997286 missense probably damaging 0.98
IGL02736:Atp1a3 APN 7 24980109 missense probably damaging 1.00
IGL02738:Atp1a3 APN 7 24990476 missense possibly damaging 0.86
IGL02806:Atp1a3 APN 7 24981872 missense probably damaging 1.00
borah UTSW 7 24994569 missense probably damaging 1.00
clonic UTSW 7 24987985 missense probably benign 0.37
R0003:Atp1a3 UTSW 7 24989564 splice site probably benign
R0254:Atp1a3 UTSW 7 24981512 splice site probably benign
R0420:Atp1a3 UTSW 7 24980627 missense probably benign
R0437:Atp1a3 UTSW 7 24998967 missense probably benign 0.36
R0666:Atp1a3 UTSW 7 24990549 missense probably benign 0.01
R0932:Atp1a3 UTSW 7 24987976 critical splice donor site probably null
R1586:Atp1a3 UTSW 7 24979383 missense probably damaging 0.97
R1981:Atp1a3 UTSW 7 25000975 missense probably benign 0.19
R2105:Atp1a3 UTSW 7 24989853 missense probably damaging 1.00
R3076:Atp1a3 UTSW 7 24980073 missense possibly damaging 0.48
R3110:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R3112:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R4223:Atp1a3 UTSW 7 25000930 missense probably benign 0.09
R4327:Atp1a3 UTSW 7 24987631 intron probably benign
R4598:Atp1a3 UTSW 7 24979341 missense probably damaging 0.99
R4626:Atp1a3 UTSW 7 24998768 missense possibly damaging 0.75
R4789:Atp1a3 UTSW 7 24998964 missense probably damaging 1.00
R4963:Atp1a3 UTSW 7 24994626 missense probably damaging 0.97
R5243:Atp1a3 UTSW 7 24994569 missense probably damaging 1.00
R5294:Atp1a3 UTSW 7 24988048 missense probably damaging 0.98
R5668:Atp1a3 UTSW 7 24978869 intron probably benign
R5704:Atp1a3 UTSW 7 24997311 missense probably damaging 0.98
R5870:Atp1a3 UTSW 7 24997578 missense probably benign 0.03
R5934:Atp1a3 UTSW 7 24978874 intron probably benign
R6183:Atp1a3 UTSW 7 24981752 missense probably damaging 1.00
R6492:Atp1a3 UTSW 7 24979304 missense probably damaging 1.00
R6996:Atp1a3 UTSW 7 24997626 missense probably damaging 1.00
R7165:Atp1a3 UTSW 7 24978965 missense probably benign 0.13
R7229:Atp1a3 UTSW 7 24987985 missense probably benign 0.37
R7239:Atp1a3 UTSW 7 25000704 missense probably damaging 1.00
R7330:Atp1a3 UTSW 7 25001152 nonsense probably null
R7348:Atp1a3 UTSW 7 24978826 missense unknown
R7432:Atp1a3 UTSW 7 25005875 unclassified probably benign
R7490:Atp1a3 UTSW 7 24987470 missense probably damaging 1.00
R7556:Atp1a3 UTSW 7 24981566 missense probably benign 0.02
R7860:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7861:Atp1a3 UTSW 7 25001148 missense unknown
R7943:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7944:Atp1a3 UTSW 7 25001148 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCATTCTGACCCCAACAGG -3'
(R):5'- AAGTGGCCTGCAGAGATGTG -3'

Sequencing Primer
(F):5'- GCAAGAGCTCAACCTGTTCCTG -3'
(R):5'- CCTGCAGAGATGTGGACAG -3'
Posted On2019-06-26