Incidental Mutation 'R7301:Nqo1'
ID566984
Institutional Source Beutler Lab
Gene Symbol Nqo1
Ensembl Gene ENSMUSG00000003849
Gene NameNAD(P)H dehydrogenase, quinone 1
SynonymsDia4, NQO1, NAD(P)H dehydrogenase (quinone), Ox1, QR1, Ox-1, NMO1, Nmor1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location107388225-107403206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107392648 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 99 (I99T)
Ref Sequence ENSEMBL: ENSMUSP00000003947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003947]
PDB Structure
CRYSTAL STRUCTURE OF MOUSE NAD[P]H-QUINONE OXIDOREDUCTASE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003947
AA Change: I99T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003947
Gene: ENSMUSG00000003849
AA Change: I99T

DomainStartEndE-ValueType
Pfam:FMN_red 4 174 6e-11 PFAM
Pfam:Flavodoxin_2 4 212 9.7e-52 PFAM
low complexity region 240 251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. This FAD-binding protein forms homodimers and reduces quinones to hydroquinones. This protein's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in this gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of this protein has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted null mice display increased toxicity to menadione, insulin resistance, an altered intracellular redox status, as well as decreased pyridine nucleotide synthesis, gluconeogenesis and fatty acid metabolism, leading to reduced quantities of abdominal adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Nqo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Nqo1 APN 8 107388955 missense probably benign 0.21
IGL02711:Nqo1 APN 8 107392931 missense probably damaging 1.00
R2289:Nqo1 UTSW 8 107392998 missense probably benign 0.42
R3011:Nqo1 UTSW 8 107389111 missense probably benign
R4419:Nqo1 UTSW 8 107392117 splice site probably null
R4420:Nqo1 UTSW 8 107392117 splice site probably null
R4659:Nqo1 UTSW 8 107391044 critical splice donor site probably null
R4832:Nqo1 UTSW 8 107388845 missense probably benign 0.27
R4955:Nqo1 UTSW 8 107388857 missense probably benign
R6018:Nqo1 UTSW 8 107388868 missense probably damaging 1.00
R6320:Nqo1 UTSW 8 107388950 missense probably benign 0.00
R7184:Nqo1 UTSW 8 107392647 missense probably damaging 1.00
R7473:Nqo1 UTSW 8 107403097 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCACTAAGAATGCAGAGGTCCCC -3'
(R):5'- TCTCTCCATTGGTAGCGGAC -3'

Sequencing Primer
(F):5'- AGGTCCCCAGGCCCATAAG -3'
(R):5'- GACCCCTGTGGCTCAGC -3'
Posted On2019-06-26