Mutagenetix > Incidental Mutation

Incidental Mutation 'R7301:Mst1r'

566985

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

045405-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R7301 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 107914790 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 842 (A842S)

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035203
AA Change: A842S

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: A842S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195617

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm3	G	A	7: 119,777,085	S345N	possibly damaging	Het
Agk	A	T	6: 40,329,517	T7S	possibly damaging	Het
Ankrd26	T	C	6: 118,511,663	E1345G	possibly damaging	Het
Atp1a3	T	A	7: 24,990,515	Y493F	probably benign	Het
Atxn2l	G	T	7: 126,494,211	Y791*	probably null	Het
Cacng8	C	A	7: 3,415,421	T363K	probably benign	Het
Camkmt	A	G	17: 85,431,493	T216A	probably benign	Het
Cd2ap	G	A	17: 42,830,013	R212*	probably null	Het
Cnppd1	A	G	1: 75,136,424	L400P	probably damaging	Het
Csmd2	C	A	4: 128,528,262	D2797E		Het
Ddx24	A	G	12: 103,419,450	M298T	possibly damaging	Het
Dpyd	T	C	3: 118,899,284	V359A	possibly damaging	Het
Dscam	T	C	16: 97,056,532	T93A	probably benign	Het
Eif2b3	T	A	4: 117,052,822	S185T	probably benign	Het
Entpd2	T	A	2: 25,400,909	I475N	possibly damaging	Het
Ercc2	C	A	7: 19,394,135	Q715K	probably benign	Het
Fam122a	T	A	19: 24,477,124	H78L	probably benign	Het
Fam122a	T	A	19: 24,477,346	E4V	probably damaging	Het
Fam186b	T	C	15: 99,278,748	R754G	probably benign	Het
Fcgbp	T	A	7: 28,093,436	V955E	possibly damaging	Het
Frrs1	T	C	3: 116,895,563	V361A	possibly damaging	Het
Gabrr2	T	A	4: 33,095,284	M391K	probably benign	Het
Gm12394	T	C	4: 42,792,923	N403S	possibly damaging	Het
Gm3409	T	A	5: 146,539,547	D169E	probably benign	Het
Gm4779	TCGGGGCCGGGGCCGGGGCCG	TCGGGGCCGGGGCCGGGGCCGGGGCCG	X: 101,794,171		probably benign	Het
Greb1l	C	G	18: 10,544,970	Q1433E	probably damaging	Het
Hal	T	C	10: 93,492,561	V233A	probably benign	Het
Ighv1-58	A	T	12: 115,312,295	N74K	probably benign	Het
Il12rb1	A	G	8: 70,813,699	I229M	possibly damaging	Het
Il17rd	T	C	14: 27,076,391	I56T	possibly damaging	Het
Itpr1	T	C	6: 108,542,024	V2708A	possibly damaging	Het
Klhl38	G	A	15: 58,322,980	R118W	probably damaging	Het
Lmf2	C	A	15: 89,355,530		probably benign	Het
Lrrc3b	T	C	14: 15,357,934	Y224C	probably damaging	Het
Med1	A	C	11: 98,152,808	F599C	probably benign	Het
Mrgprb4	A	G	7: 48,198,758	S141P	probably damaging	Het
Myo3a	T	C	2: 22,544,466		probably null	Het
Nos1	A	T	5: 117,867,905	D230V	possibly damaging	Het
Nppb	T	C	4: 147,986,323	S52P	probably benign	Het
Nqo1	A	G	8: 107,392,648	I99T	probably damaging	Het
Olfr346	T	A	2: 36,688,011	M3K	probably benign	Het
Olfr769	T	C	10: 129,111,699	H242R	probably damaging	Het
Pcdha3	G	A	18: 36,946,924	E240K	possibly damaging	Het
Plpp7	T	G	2: 32,096,055	F82V	probably benign	Het
Podxl	G	T	6: 31,524,436	P395T	probably damaging	Het
Prr5l	T	A	2: 101,717,286	D298V	probably damaging	Het
Rad9b	A	G	5: 122,352,614	V13A	possibly damaging	Het
Rasl2-9	A	G	7: 5,125,740	W64R	probably damaging	Het
Rilp	G	T	11: 75,510,116		probably benign	Het
Ripor2	T	C	13: 24,725,001	I1034T	possibly damaging	Het
Rtn4ip1	T	C	10: 43,936,020	Y338H	probably damaging	Het
Shisa5	G	T	9: 109,054,884		probably benign	Het
Slc27a4	C	T	2: 29,812,932	T591I	probably null	Het
Snx24	G	T	18: 53,340,172	V63F	probably damaging	Het
Sptbn1	A	T	11: 30,117,798	Y1805*	probably null	Het
Svep1	G	A	4: 58,046,587	Q3515*	probably null	Het
Synpo2	A	C	3: 123,114,053	M538R	probably benign	Het
Tfap2a	T	C	13: 40,721,308	K276E	probably damaging	Het
Tmem158	C	A	9: 123,260,301	S82I	probably damaging	Het
Tmtc3	G	T	10: 100,447,474	H740N	not run	Het
Top3a	A	T	11: 60,748,148	F559I	probably damaging	Het
Tysnd1	C	A	10: 61,696,549	P327T	possibly damaging	Het
Ulk4	T	A	9: 121,145,059	D969V	probably benign	Het
Vcan	T	A	13: 89,705,266	Y525F	probably benign	Het
Vmn1r127	A	G	7: 21,319,053	F270S	probably benign	Het
Vmn1r204	G	A	13: 22,556,805	S202N	probably damaging	Het
Vmn2r107	A	G	17: 20,345,616	I64M	probably benign	Het
Zfp280b	C	G	10: 76,038,703	Q139E	probably damaging	Het
Zfp322a	C	A	13: 23,357,143	G143V	probably damaging	Het
Zfp322a	C	T	13: 23,357,144	G143S	probably benign	Het
Zfyve26	A	T	12: 79,282,984	V476D	probably benign	Het
Zkscan6	A	T	11: 65,828,225	H357L	probably benign	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCATGGCACTTCACGCTATC -3'
(R):5'- GAAGGATCAGCCAGAGTCTG -3'

Sequencing Primer
(F):5'- TCCATGATGGACAAAGTACAGTG -3'
(R):5'- GGCTCTGCCTCCTTATCCG -3'

Posted On

2019-06-26