Incidental Mutation 'R7301:Zfp280b'
ID 566991
Institutional Source Beutler Lab
Gene Symbol Zfp280b
Ensembl Gene ENSMUSG00000049764
Gene Name zinc finger protein 280B
Synonyms Suhw2, D10Jhu82e
MMRRC Submission 045405-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 75868235-75878804 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 75874537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 139 (Q139E)
Ref Sequence ENSEMBL: ENSMUSP00000056340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]
AlphaFold Q505F4
Predicted Effect probably damaging
Transcript: ENSMUST00000061617
AA Change: Q139E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: Q139E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 29 37 N/A INTRINSIC
Pfam:DUF4195 53 227 1.3e-38 PFAM
ZnF_C2H2 297 318 3.65e1 SMART
ZnF_C2H2 334 357 9.46e0 SMART
ZnF_C2H2 364 387 8.22e-2 SMART
ZnF_C2H2 394 417 4.23e0 SMART
ZnF_C2H2 423 445 1.72e1 SMART
ZnF_C2H2 451 474 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,376,308 (GRCm39) S345N possibly damaging Het
Agk A T 6: 40,306,451 (GRCm39) T7S possibly damaging Het
Ankrd26 T C 6: 118,488,624 (GRCm39) E1345G possibly damaging Het
Atp1a3 T A 7: 24,689,940 (GRCm39) Y493F probably benign Het
Atxn2l G T 7: 126,093,383 (GRCm39) Y791* probably null Het
Cacng8 C A 7: 3,463,937 (GRCm39) T363K probably benign Het
Camkmt A G 17: 85,738,921 (GRCm39) T216A probably benign Het
Cd2ap G A 17: 43,140,904 (GRCm39) R212* probably null Het
Cnppd1 A G 1: 75,113,068 (GRCm39) L400P probably damaging Het
Csmd2 C A 4: 128,422,055 (GRCm39) D2797E Het
Ddx24 A G 12: 103,385,709 (GRCm39) M298T possibly damaging Het
Dpyd T C 3: 118,692,933 (GRCm39) V359A possibly damaging Het
Dscam T C 16: 96,857,732 (GRCm39) T93A probably benign Het
Eif2b3 T A 4: 116,910,019 (GRCm39) S185T probably benign Het
Entpd2 T A 2: 25,290,921 (GRCm39) I475N possibly damaging Het
Ercc2 C A 7: 19,128,060 (GRCm39) Q715K probably benign Het
Fam186b T C 15: 99,176,629 (GRCm39) R754G probably benign Het
Fcgbp T A 7: 27,792,861 (GRCm39) V955E possibly damaging Het
Frrs1 T C 3: 116,689,212 (GRCm39) V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 (GRCm39) M391K probably benign Het
Gm3409 T A 5: 146,476,357 (GRCm39) D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 100,837,777 (GRCm39) probably benign Het
Greb1l C G 18: 10,544,970 (GRCm39) Q1433E probably damaging Het
Hal T C 10: 93,328,423 (GRCm39) V233A probably benign Het
Ighv1-58 A T 12: 115,275,915 (GRCm39) N74K probably benign Het
Il12rb1 A G 8: 71,266,343 (GRCm39) I229M possibly damaging Het
Il17rd T C 14: 26,798,348 (GRCm39) I56T possibly damaging Het
Itpr1 T C 6: 108,518,985 (GRCm39) V2708A possibly damaging Het
Klhl38 G A 15: 58,186,376 (GRCm39) R118W probably damaging Het
Lmf2 C A 15: 89,239,733 (GRCm39) probably benign Het
Lrrc3b T C 14: 15,357,934 (GRCm38) Y224C probably damaging Het
Med1 A C 11: 98,043,634 (GRCm39) F599C probably benign Het
Mrgprb4 A G 7: 47,848,506 (GRCm39) S141P probably damaging Het
Mst1r G T 9: 107,791,989 (GRCm39) A842S possibly damaging Het
Myo3a T C 2: 22,436,504 (GRCm39) probably null Het
Nos1 A T 5: 118,005,970 (GRCm39) D230V possibly damaging Het
Nppb T C 4: 148,070,780 (GRCm39) S52P probably benign Het
Nqo1 A G 8: 108,119,280 (GRCm39) I99T probably damaging Het
Or1j17 T A 2: 36,578,023 (GRCm39) M3K probably benign Het
Or6c2b T C 10: 128,947,568 (GRCm39) H242R probably damaging Het
Pabir1 T A 19: 24,454,488 (GRCm39) H78L probably benign Het
Pabir1 T A 19: 24,454,710 (GRCm39) E4V probably damaging Het
Pcdha3 G A 18: 37,079,977 (GRCm39) E240K possibly damaging Het
Plpp7 T G 2: 31,986,067 (GRCm39) F82V probably benign Het
Podxl G T 6: 31,501,371 (GRCm39) P395T probably damaging Het
Prr5l T A 2: 101,547,631 (GRCm39) D298V probably damaging Het
Rad9b A G 5: 122,490,677 (GRCm39) V13A possibly damaging Het
Rasl2-9 A G 7: 5,128,739 (GRCm39) W64R probably damaging Het
Rilp G T 11: 75,400,942 (GRCm39) probably benign Het
Ripor2 T C 13: 24,908,984 (GRCm39) I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,812,016 (GRCm39) Y338H probably damaging Het
Shisa5 G T 9: 108,883,952 (GRCm39) probably benign Het
Slc27a4 C T 2: 29,702,944 (GRCm39) T591I probably null Het
Snx24 G T 18: 53,473,244 (GRCm39) V63F probably damaging Het
Spata31f1e T C 4: 42,792,923 (GRCm39) N403S possibly damaging Het
Sptbn1 A T 11: 30,067,798 (GRCm39) Y1805* probably null Het
Svep1 G A 4: 58,046,587 (GRCm39) Q3515* probably null Het
Synpo2 A C 3: 122,907,702 (GRCm39) M538R probably benign Het
Tfap2a T C 13: 40,874,784 (GRCm39) K276E probably damaging Het
Tmem158 C A 9: 123,089,366 (GRCm39) S82I probably damaging Het
Tmtc3 G T 10: 100,283,336 (GRCm39) H740N not run Het
Top3a A T 11: 60,638,974 (GRCm39) F559I probably damaging Het
Tysnd1 C A 10: 61,532,328 (GRCm39) P327T possibly damaging Het
Ulk4 T A 9: 120,974,125 (GRCm39) D969V probably benign Het
Vcan T A 13: 89,853,385 (GRCm39) Y525F probably benign Het
Vmn1r127 A G 7: 21,052,978 (GRCm39) F270S probably benign Het
Vmn1r204 G A 13: 22,740,975 (GRCm39) S202N probably damaging Het
Vmn2r107 A G 17: 20,565,878 (GRCm39) I64M probably benign Het
Zfp322a C A 13: 23,541,313 (GRCm39) G143V probably damaging Het
Zfp322a C T 13: 23,541,314 (GRCm39) G143S probably benign Het
Zfyve26 A T 12: 79,329,758 (GRCm39) V476D probably benign Het
Zkscan6 A T 11: 65,719,051 (GRCm39) H357L probably benign Het
Other mutations in Zfp280b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Zfp280b APN 10 75,875,497 (GRCm39) missense probably damaging 0.99
IGL02016:Zfp280b APN 10 75,874,945 (GRCm39) missense possibly damaging 0.68
IGL02245:Zfp280b APN 10 75,875,197 (GRCm39) missense probably benign
IGL03233:Zfp280b APN 10 75,875,603 (GRCm39) missense probably damaging 1.00
R0864:Zfp280b UTSW 10 75,874,139 (GRCm39) missense probably benign 0.00
R1501:Zfp280b UTSW 10 75,875,603 (GRCm39) missense probably damaging 1.00
R1643:Zfp280b UTSW 10 75,875,444 (GRCm39) missense probably damaging 1.00
R2004:Zfp280b UTSW 10 75,874,370 (GRCm39) missense probably benign 0.00
R2024:Zfp280b UTSW 10 75,874,328 (GRCm39) missense probably damaging 1.00
R2025:Zfp280b UTSW 10 75,874,328 (GRCm39) missense probably damaging 1.00
R2027:Zfp280b UTSW 10 75,874,328 (GRCm39) missense probably damaging 1.00
R2064:Zfp280b UTSW 10 75,875,017 (GRCm39) missense probably damaging 1.00
R3729:Zfp280b UTSW 10 75,874,936 (GRCm39) missense probably benign 0.33
R4634:Zfp280b UTSW 10 75,874,663 (GRCm39) missense probably benign 0.00
R4812:Zfp280b UTSW 10 75,874,924 (GRCm39) missense probably benign 0.24
R4968:Zfp280b UTSW 10 75,875,188 (GRCm39) missense probably damaging 1.00
R5007:Zfp280b UTSW 10 75,875,048 (GRCm39) missense probably damaging 1.00
R5123:Zfp280b UTSW 10 75,875,183 (GRCm39) missense probably benign 0.02
R5503:Zfp280b UTSW 10 75,875,296 (GRCm39) splice site probably null
R5552:Zfp280b UTSW 10 75,875,497 (GRCm39) nonsense probably null
R6954:Zfp280b UTSW 10 75,875,522 (GRCm39) missense probably benign 0.36
R7299:Zfp280b UTSW 10 75,874,537 (GRCm39) missense probably damaging 0.98
R7485:Zfp280b UTSW 10 75,875,075 (GRCm39) missense probably damaging 1.00
R9170:Zfp280b UTSW 10 75,874,651 (GRCm39) missense probably benign 0.22
R9346:Zfp280b UTSW 10 75,875,126 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAGCATGACCGACTTAGAGC -3'
(R):5'- GTCCTCTGTTGCATATTCGAGG -3'

Sequencing Primer
(F):5'- TTAGAGCAACCACGACTCAGAGG -3'
(R):5'- GCTGAAGAAAGTGGTTCTACAATCTC -3'
Posted On 2019-06-26