Incidental Mutation 'R7301:Rilp'
ID 566998
Institutional Source Beutler Lab
Gene Symbol Rilp
Ensembl Gene ENSMUSG00000038195
Gene Name Rab interacting lysosomal protein
Synonyms LOC333615
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 75510094-75513168 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 75510116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000042808] [ENSMUST00000042972] [ENSMUST00000102510] [ENSMUST00000118243] [ENSMUST00000123819]
AlphaFold Q5ND29
Predicted Effect probably benign
Transcript: ENSMUST00000018449
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042808
SMART Domains Protein: ENSMUSP00000044248
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042972
SMART Domains Protein: ENSMUSP00000037238
Gene: ENSMUSG00000038195

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:Jnk-SapK_ap_N 27 195 2.1e-16 PFAM
Pfam:RILP 223 281 1.1e-21 PFAM
low complexity region 289 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102510
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118243
SMART Domains Protein: ENSMUSP00000114090
Gene: ENSMUSG00000038188

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 54 90 2.16e1 SMART
EGF 101 133 1.36e1 SMART
EGF_like 165 193 4.55e1 SMART
EGF_Lam 225 263 8.78e-2 SMART
EGF_like 262 296 4.93e1 SMART
EGF 307 341 2.69e1 SMART
EGF 352 384 2.25e1 SMART
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123819
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal protein that interacts with RAB7, a small GTPase that controls transport to endocytic degradative compartments. Studies using mutant forms of the two proteins suggest that this protein represents a downstream effector for RAB7, and both proteins act together in the regulation of late endocytic traffic. A unique region of this protein has also been shown to be involved in the regulation of lysosomal morphology. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Rilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02233:Rilp APN 11 75512712 missense probably damaging 1.00
R0148:Rilp UTSW 11 75510233 missense probably damaging 0.98
R0240:Rilp UTSW 11 75510921 missense probably benign 0.00
R1964:Rilp UTSW 11 75510502 missense probably benign 0.20
R1988:Rilp UTSW 11 75510933 splice site probably null
R4599:Rilp UTSW 11 75512760 missense probably benign
R4661:Rilp UTSW 11 75511424 missense probably damaging 1.00
R4783:Rilp UTSW 11 75510641 missense possibly damaging 0.91
R5134:Rilp UTSW 11 75512708 missense probably damaging 0.99
R5558:Rilp UTSW 11 75511425 missense probably damaging 1.00
R5723:Rilp UTSW 11 75512861 unclassified probably benign
R6576:Rilp UTSW 11 75512392 splice site probably null
R6792:Rilp UTSW 11 75512775 nonsense probably null
R7016:Rilp UTSW 11 75510919 missense probably damaging 0.99
R7396:Rilp UTSW 11 75510886 missense probably damaging 0.98
R7698:Rilp UTSW 11 75510972 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTTGGCCGACCTGTATC -3'
(R):5'- CCTTTTCCAAGAGCTCCAGC -3'

Sequencing Primer
(F):5'- GACCTGTATCCAGTGACCTTGTAG -3'
(R):5'- ACGACTAGTGGCACCAGC -3'
Posted On 2019-06-26