Incidental Mutation 'R7301:Tfap2a'
ID567007
Institutional Source Beutler Lab
Gene Symbol Tfap2a
Ensembl Gene ENSMUSG00000021359
Gene Nametranscription factor AP-2, alpha
SynonymsTcfap2a, Ap2, Ap-2 (a), AP-2 alpha, Ap2tf, AP2alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location40715302-40738376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40721308 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 276 (K276E)
Ref Sequence ENSEMBL: ENSMUSP00000021787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021787] [ENSMUST00000110193] [ENSMUST00000223869] [ENSMUST00000224665] [ENSMUST00000224999] [ENSMUST00000225180]
Predicted Effect probably damaging
Transcript: ENSMUST00000021787
AA Change: K276E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021787
Gene: ENSMUSG00000021359
AA Change: K276E

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 82 95 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
Pfam:TF_AP-2 201 408 1.6e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110193
AA Change: K282E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105822
Gene: ENSMUSG00000021359
AA Change: K282E

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
Pfam:TF_AP-2 209 409 7.8e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223869
AA Change: K278E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224665
AA Change: K284E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224999
AA Change: K284E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225180
AA Change: K311E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the activator protein 2 (AP-2) transcription factor family. The protein encoded by this gene can act as both an activator and repressor of gene transcription, and plays an important role in early embryogenesis, specifically in cranial development. This protein forms both homodimers and heterodimers, and binds to a GC-rich consensus sequence found in some promoters and enhancers. Disruption of this gene causes perinatal death, with neural tube, craniofacial, and limb mesenchyme defects. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die perinatally with anencephaly, craniofacial and neural tube defects, thoraco-abdominoschisis and defects in sensory organs, cranial ganglia, skeleton, and heart. On some genetic backgrounds, heterozygotes may exhibit exencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Tfap2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4366001:Tfap2a UTSW 13 40721374 missense possibly damaging 0.67
R0124:Tfap2a UTSW 13 40717411 splice site probably benign
R0400:Tfap2a UTSW 13 40717412 splice site probably benign
R0486:Tfap2a UTSW 13 40728694 missense probably damaging 1.00
R1132:Tfap2a UTSW 13 40721391 splice site probably null
R1418:Tfap2a UTSW 13 40717204 missense possibly damaging 0.89
R1751:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1767:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1802:Tfap2a UTSW 13 40725170 missense probably damaging 1.00
R1865:Tfap2a UTSW 13 40728408 missense probably damaging 1.00
R4913:Tfap2a UTSW 13 40717230 missense probably damaging 1.00
R5764:Tfap2a UTSW 13 40728355 missense possibly damaging 0.64
R6378:Tfap2a UTSW 13 40723241 missense possibly damaging 0.48
R6496:Tfap2a UTSW 13 40728775 missense probably damaging 1.00
R6751:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6773:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6774:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6786:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R7027:Tfap2a UTSW 13 40733674 missense probably benign 0.02
R7140:Tfap2a UTSW 13 40730047 missense probably benign 0.19
R7268:Tfap2a UTSW 13 40728760 missense possibly damaging 0.91
R7299:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7689:Tfap2a UTSW 13 40728575 missense probably damaging 1.00
R7761:Tfap2a UTSW 13 40725180 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TACATTCCATGGAAAAGTGAAGCC -3'
(R):5'- AGTTGCAATGACAACTATGCC -3'

Sequencing Primer
(F):5'- AGTGAAGCCACCCAAAGG -3'
(R):5'- TGCCTTGGAACCATGACC -3'
Posted On2019-06-26