Mutagenetix > Incidental Mutations

Incidental Mutation 'R7301:Lrrc3b'

567009

Institutional Source

Beutler Lab

Gene Symbol

Lrrc3b

Ensembl Gene

ENSMUSG00000045201

Gene Name

leucine rich repeat containing 3B

Synonyms

LRP15

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7301 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15357515-15438987 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15357934 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 224 (Y224C)

Ref Sequence

ENSEMBL: ENSMUSP00000059463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055211
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: Y224C

Domain	Start	End	E-Value	Type
LRRNT	33	68	1.85e-8	SMART
LRR	67	86	3e1	SMART
LRR_TYP	87	110	8.94e-3	SMART
LRR	115	135	3.86e0	SMART
Blast:LRRCT	145	196	2e-8	BLAST
transmembrane domain	203	225	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163937
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: Y224C

Domain	Start	End	E-Value	Type
LRRNT	33	68	1.85e-8	SMART
LRR	67	86	3e1	SMART
LRR_TYP	87	110	8.94e-3	SMART
LRR	115	135	3.86e0	SMART
Blast:LRRCT	145	196	2e-8	BLAST
transmembrane domain	203	225	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000223700
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm3	G	A	7: 119,777,085	S345N	possibly damaging	Het
Agk	A	T	6: 40,329,517	T7S	possibly damaging	Het
Ankrd26	T	C	6: 118,511,663	E1345G	possibly damaging	Het
Atp1a3	T	A	7: 24,990,515	Y493F	probably benign	Het
Atxn2l	G	T	7: 126,494,211	Y791*	probably null	Het
Cacng8	C	A	7: 3,415,421	T363K	probably benign	Het
Camkmt	A	G	17: 85,431,493	T216A	probably benign	Het
Cd2ap	G	A	17: 42,830,013	R212*	probably null	Het
Cnppd1	A	G	1: 75,136,424	L400P	probably damaging	Het
Csmd2	C	A	4: 128,528,262	D2797E		Het
Ddx24	A	G	12: 103,419,450	M298T	possibly damaging	Het
Dpyd	T	C	3: 118,899,284	V359A	possibly damaging	Het
Dscam	T	C	16: 97,056,532	T93A	probably benign	Het
Eif2b3	T	A	4: 117,052,822	S185T	probably benign	Het
Entpd2	T	A	2: 25,400,909	I475N	possibly damaging	Het
Ercc2	C	A	7: 19,394,135	Q715K	probably benign	Het
Fam122a	T	A	19: 24,477,124	H78L	probably benign	Het
Fam122a	T	A	19: 24,477,346	E4V	probably damaging	Het
Fam186b	T	C	15: 99,278,748	R754G	probably benign	Het
Fcgbp	T	A	7: 28,093,436	V955E	possibly damaging	Het
Frrs1	T	C	3: 116,895,563	V361A	possibly damaging	Het
Gabrr2	T	A	4: 33,095,284	M391K	probably benign	Het
Gm12394	T	C	4: 42,792,923	N403S	possibly damaging	Het
Gm3409	T	A	5: 146,539,547	D169E	probably benign	Het
Gm4779	TCGGGGCCGGGGCCGGGGCCG	TCGGGGCCGGGGCCGGGGCCGGGGCCG	X: 101,794,171		probably benign	Het
Greb1l	C	G	18: 10,544,970	Q1433E	probably damaging	Het
Hal	T	C	10: 93,492,561	V233A	probably benign	Het
Ighv1-58	A	T	12: 115,312,295	N74K	probably benign	Het
Il12rb1	A	G	8: 70,813,699	I229M	possibly damaging	Het
Il17rd	T	C	14: 27,076,391	I56T	possibly damaging	Het
Itpr1	T	C	6: 108,542,024	V2708A	possibly damaging	Het
Klhl38	G	A	15: 58,322,980	R118W	probably damaging	Het
Lmf2	C	A	15: 89,355,530		probably benign	Het
Med1	A	C	11: 98,152,808	F599C	probably benign	Het
Mrgprb4	A	G	7: 48,198,758	S141P	probably damaging	Het
Mst1r	G	T	9: 107,914,790	A842S	possibly damaging	Het
Myo3a	T	C	2: 22,544,466		probably null	Het
Nos1	A	T	5: 117,867,905	D230V	possibly damaging	Het
Nppb	T	C	4: 147,986,323	S52P	probably benign	Het
Nqo1	A	G	8: 107,392,648	I99T	probably damaging	Het
Olfr346	T	A	2: 36,688,011	M3K	probably benign	Het
Olfr769	T	C	10: 129,111,699	H242R	probably damaging	Het
Pcdha3	G	A	18: 36,946,924	E240K	possibly damaging	Het
Plpp7	T	G	2: 32,096,055	F82V	probably benign	Het
Podxl	G	T	6: 31,524,436	P395T	probably damaging	Het
Prr5l	T	A	2: 101,717,286	D298V	probably damaging	Het
Rad9b	A	G	5: 122,352,614	V13A	possibly damaging	Het
Rasl2-9	A	G	7: 5,125,740	W64R	probably damaging	Het
Rilp	G	T	11: 75,510,116		probably benign	Het
Ripor2	T	C	13: 24,725,001	I1034T	possibly damaging	Het
Rtn4ip1	T	C	10: 43,936,020	Y338H	probably damaging	Het
Shisa5	G	T	9: 109,054,884		probably benign	Het
Slc27a4	C	T	2: 29,812,932	T591I	probably null	Het
Snx24	G	T	18: 53,340,172	V63F	probably damaging	Het
Sptbn1	A	T	11: 30,117,798	Y1805*	probably null	Het
Svep1	G	A	4: 58,046,587	Q3515*	probably null	Het
Synpo2	A	C	3: 123,114,053	M538R	probably benign	Het
Tfap2a	T	C	13: 40,721,308	K276E	probably damaging	Het
Tmem158	C	A	9: 123,260,301	S82I	probably damaging	Het
Tmtc3	G	T	10: 100,447,474	H740N	not run	Het
Top3a	A	T	11: 60,748,148	F559I	probably damaging	Het
Tysnd1	C	A	10: 61,696,549	P327T	possibly damaging	Het
Ulk4	T	A	9: 121,145,059	D969V	probably benign	Het
Vcan	T	A	13: 89,705,266	Y525F	probably benign	Het
Vmn1r127	A	G	7: 21,319,053	F270S	probably benign	Het
Vmn1r204	G	A	13: 22,556,805	S202N	probably damaging	Het
Vmn2r107	A	G	17: 20,345,616	I64M	probably benign	Het
Zfp280b	C	G	10: 76,038,703	Q139E	probably damaging	Het
Zfp322a	C	A	13: 23,357,143	G143V	probably damaging	Het
Zfp322a	C	T	13: 23,357,144	G143S	probably benign	Het
Zfyve26	A	T	12: 79,282,984	V476D	probably benign	Het
Zkscan6	A	T	11: 65,828,225	H357L	probably benign	Het

Other mutations in Lrrc3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Lrrc3b	APN	14	15358098	missense	probably benign	0.00
IGL03141:Lrrc3b	APN	14	15358390	missense	probably damaging	1.00
Klutz	UTSW	14	15357946	missense	probably damaging	1.00
BB008:Lrrc3b	UTSW	14	15358018	missense	probably benign	0.36
BB018:Lrrc3b	UTSW	14	15358018	missense	probably benign	0.36
PIT4810001:Lrrc3b	UTSW	14	15358273	missense	probably benign	0.17
R0371:Lrrc3b	UTSW	14	15358560	nonsense	probably null
R1750:Lrrc3b	UTSW	14	15358601	missense	probably benign	0.00
R2280:Lrrc3b	UTSW	14	15358076	missense	probably damaging	0.99
R4663:Lrrc3b	UTSW	14	15358220	missense	probably benign	0.01
R4929:Lrrc3b	UTSW	14	15357888	missense	probably damaging	1.00
R5344:Lrrc3b	UTSW	14	15358591	missense	probably damaging	1.00
R6537:Lrrc3b	UTSW	14	15357946	missense	probably damaging	1.00
R7931:Lrrc3b	UTSW	14	15358018	missense	probably benign	0.36
R8113:Lrrc3b	UTSW	14	15358232	missense	probably benign	0.01
R8220:Lrrc3b	UTSW	14	15358004	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGGCATGATTCCAAAGAAAC -3'
(R):5'- CAGCACACAATGTGATTTGCAAG -3'

Sequencing Primer
(F):5'- TTTTAAATGTGTACAATGAAGGGGG -3'
(R):5'- GACATCAGTGTTGGATGAGCAC -3'

Posted On

2019-06-26