Incidental Mutation 'R7301:Lrrc3b'
ID567009
Institutional Source Beutler Lab
Gene Symbol Lrrc3b
Ensembl Gene ENSMUSG00000045201
Gene Nameleucine rich repeat containing 3B
SynonymsLRP15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location15357515-15438987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15357934 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 224 (Y224C)
Ref Sequence ENSEMBL: ENSMUSP00000059463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]
Predicted Effect probably damaging
Transcript: ENSMUST00000055211
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: Y224C

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163937
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: Y224C

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223700
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Lrrc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lrrc3b APN 14 15358098 missense probably benign 0.00
IGL03141:Lrrc3b APN 14 15358390 missense probably damaging 1.00
Klutz UTSW 14 15357946 missense probably damaging 1.00
PIT4810001:Lrrc3b UTSW 14 15358273 missense probably benign 0.17
R0371:Lrrc3b UTSW 14 15358560 nonsense probably null
R1750:Lrrc3b UTSW 14 15358601 missense probably benign 0.00
R2280:Lrrc3b UTSW 14 15358076 missense probably damaging 0.99
R4663:Lrrc3b UTSW 14 15358220 missense probably benign 0.01
R4929:Lrrc3b UTSW 14 15357888 missense probably damaging 1.00
R5344:Lrrc3b UTSW 14 15358591 missense probably damaging 1.00
R6537:Lrrc3b UTSW 14 15357946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGCATGATTCCAAAGAAAC -3'
(R):5'- CAGCACACAATGTGATTTGCAAG -3'

Sequencing Primer
(F):5'- TTTTAAATGTGTACAATGAAGGGGG -3'
(R):5'- GACATCAGTGTTGGATGAGCAC -3'
Posted On2019-06-26