Incidental Mutation 'R7301:Il17rd'
ID567010
Institutional Source Beutler Lab
Gene Symbol Il17rd
Ensembl Gene ENSMUSG00000040717
Gene Nameinterleukin 17 receptor D
Synonyms2810004A10Rik, Sef, Sef-S
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location27038941-27107286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27076391 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 56 (I56T)
Ref Sequence ENSEMBL: ENSMUSP00000036076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035336] [ENSMUST00000223942] [ENSMUST00000225146] [ENSMUST00000226105]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035336
AA Change: I56T

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036076
Gene: ENSMUSG00000040717
AA Change: I56T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:IL17R_D_N 48 169 2.7e-68 PFAM
Pfam:SEFIR 356 511 9.6e-56 PFAM
low complexity region 667 684 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223942
AA Change: I56T

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000225146
Predicted Effect probably benign
Transcript: ENSMUST00000226105
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein belonging to the interleukin-17 receptor (IL-17R) protein family. The encoded protein is a component of the interleukin-17 receptor signaling complex, and the interaction between this protein and IL-17R does not require the interleukin. The gene product also affects fibroblast growth factor signaling, inhibiting or stimulating growth through MAPK/ERK signaling. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and show no obvious phenotype. A subset of mice homozygous for a gene-trapped allele display cochlear nucleus defects and abnormal auditory brainstem responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cd2ap G A 17: 42,830,013 R212* probably null Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Il17rd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Il17rd APN 14 27095944 missense probably damaging 1.00
IGL02274:Il17rd APN 14 27099910 missense probably damaging 1.00
IGL02732:Il17rd APN 14 27087419 missense probably damaging 1.00
IGL03118:Il17rd APN 14 27093395 critical splice acceptor site probably null
IGL03175:Il17rd APN 14 27100006 missense probably damaging 1.00
FR4304:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4449:Il17rd UTSW 14 27082678 utr 5 prime probably benign
FR4737:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4976:Il17rd UTSW 14 27082677 utr 5 prime probably benign
R0063:Il17rd UTSW 14 27082733 missense probably damaging 1.00
R0063:Il17rd UTSW 14 27082734 nonsense probably null
R0076:Il17rd UTSW 14 27094854 missense probably damaging 1.00
R0452:Il17rd UTSW 14 27091931 missense probably damaging 1.00
R1540:Il17rd UTSW 14 27099958 missense probably damaging 1.00
R1760:Il17rd UTSW 14 27091806 nonsense probably null
R2192:Il17rd UTSW 14 27094878 missense probably damaging 1.00
R2886:Il17rd UTSW 14 27099553 missense probably damaging 1.00
R3688:Il17rd UTSW 14 27039148 missense probably null 0.14
R4534:Il17rd UTSW 14 27096062 missense probably damaging 0.98
R5042:Il17rd UTSW 14 27096041 missense probably damaging 1.00
R5410:Il17rd UTSW 14 27095911 missense probably damaging 1.00
R5528:Il17rd UTSW 14 27088067 missense possibly damaging 0.94
R5829:Il17rd UTSW 14 27092085 splice site probably null
R5919:Il17rd UTSW 14 27096044 missense probably damaging 0.99
R6305:Il17rd UTSW 14 27095942 missense possibly damaging 0.77
R6739:Il17rd UTSW 14 27099531 missense possibly damaging 0.55
R6829:Il17rd UTSW 14 27087422 nonsense probably null
R7336:Il17rd UTSW 14 27087546 missense probably benign 0.00
R7521:Il17rd UTSW 14 27094866 missense probably benign 0.05
R7649:Il17rd UTSW 14 27039210 missense probably benign 0.22
R7741:Il17rd UTSW 14 27100336 missense probably damaging 1.00
R7814:Il17rd UTSW 14 27100117 missense probably benign 0.20
Z1177:Il17rd UTSW 14 27100261 missense not run
Predicted Primers PCR Primer
(F):5'- AGCATTCCCTTGGACTGGAG -3'
(R):5'- TTTGGCAGCTTGATGTAGACTAC -3'

Sequencing Primer
(F):5'- GTCATGGGGTAGTGCAAGG -3'
(R):5'- GCAGCTTGATGTAGACTACAATGC -3'
Posted On2019-06-26