Incidental Mutation 'R7301:Vmn2r107'
ID 567015
Institutional Source Beutler Lab
Gene Symbol Vmn2r107
Ensembl Gene ENSMUSG00000056910
Gene Name vomeronasal 2, receptor 107
Synonyms V2r6
MMRRC Submission 045405-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20565687-20596034 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20565878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 64 (I64M)
Ref Sequence ENSEMBL: ENSMUSP00000048706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042090]
AlphaFold E9PZJ7
Predicted Effect probably benign
Transcript: ENSMUST00000042090
AA Change: I64M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: I64M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 466 3.6e-40 PFAM
Pfam:NCD3G 509 562 5.1e-21 PFAM
Pfam:7tm_3 593 830 8e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,376,308 (GRCm39) S345N possibly damaging Het
Agk A T 6: 40,306,451 (GRCm39) T7S possibly damaging Het
Ankrd26 T C 6: 118,488,624 (GRCm39) E1345G possibly damaging Het
Atp1a3 T A 7: 24,689,940 (GRCm39) Y493F probably benign Het
Atxn2l G T 7: 126,093,383 (GRCm39) Y791* probably null Het
Cacng8 C A 7: 3,463,937 (GRCm39) T363K probably benign Het
Camkmt A G 17: 85,738,921 (GRCm39) T216A probably benign Het
Cd2ap G A 17: 43,140,904 (GRCm39) R212* probably null Het
Cnppd1 A G 1: 75,113,068 (GRCm39) L400P probably damaging Het
Csmd2 C A 4: 128,422,055 (GRCm39) D2797E Het
Ddx24 A G 12: 103,385,709 (GRCm39) M298T possibly damaging Het
Dpyd T C 3: 118,692,933 (GRCm39) V359A possibly damaging Het
Dscam T C 16: 96,857,732 (GRCm39) T93A probably benign Het
Eif2b3 T A 4: 116,910,019 (GRCm39) S185T probably benign Het
Entpd2 T A 2: 25,290,921 (GRCm39) I475N possibly damaging Het
Ercc2 C A 7: 19,128,060 (GRCm39) Q715K probably benign Het
Fam186b T C 15: 99,176,629 (GRCm39) R754G probably benign Het
Fcgbp T A 7: 27,792,861 (GRCm39) V955E possibly damaging Het
Frrs1 T C 3: 116,689,212 (GRCm39) V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 (GRCm39) M391K probably benign Het
Gm3409 T A 5: 146,476,357 (GRCm39) D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 100,837,777 (GRCm39) probably benign Het
Greb1l C G 18: 10,544,970 (GRCm39) Q1433E probably damaging Het
Hal T C 10: 93,328,423 (GRCm39) V233A probably benign Het
Ighv1-58 A T 12: 115,275,915 (GRCm39) N74K probably benign Het
Il12rb1 A G 8: 71,266,343 (GRCm39) I229M possibly damaging Het
Il17rd T C 14: 26,798,348 (GRCm39) I56T possibly damaging Het
Itpr1 T C 6: 108,518,985 (GRCm39) V2708A possibly damaging Het
Klhl38 G A 15: 58,186,376 (GRCm39) R118W probably damaging Het
Lmf2 C A 15: 89,239,733 (GRCm39) probably benign Het
Lrrc3b T C 14: 15,357,934 (GRCm38) Y224C probably damaging Het
Med1 A C 11: 98,043,634 (GRCm39) F599C probably benign Het
Mrgprb4 A G 7: 47,848,506 (GRCm39) S141P probably damaging Het
Mst1r G T 9: 107,791,989 (GRCm39) A842S possibly damaging Het
Myo3a T C 2: 22,436,504 (GRCm39) probably null Het
Nos1 A T 5: 118,005,970 (GRCm39) D230V possibly damaging Het
Nppb T C 4: 148,070,780 (GRCm39) S52P probably benign Het
Nqo1 A G 8: 108,119,280 (GRCm39) I99T probably damaging Het
Or1j17 T A 2: 36,578,023 (GRCm39) M3K probably benign Het
Or6c2b T C 10: 128,947,568 (GRCm39) H242R probably damaging Het
Pabir1 T A 19: 24,454,488 (GRCm39) H78L probably benign Het
Pabir1 T A 19: 24,454,710 (GRCm39) E4V probably damaging Het
Pcdha3 G A 18: 37,079,977 (GRCm39) E240K possibly damaging Het
Plpp7 T G 2: 31,986,067 (GRCm39) F82V probably benign Het
Podxl G T 6: 31,501,371 (GRCm39) P395T probably damaging Het
Prr5l T A 2: 101,547,631 (GRCm39) D298V probably damaging Het
Rad9b A G 5: 122,490,677 (GRCm39) V13A possibly damaging Het
Rasl2-9 A G 7: 5,128,739 (GRCm39) W64R probably damaging Het
Rilp G T 11: 75,400,942 (GRCm39) probably benign Het
Ripor2 T C 13: 24,908,984 (GRCm39) I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,812,016 (GRCm39) Y338H probably damaging Het
Shisa5 G T 9: 108,883,952 (GRCm39) probably benign Het
Slc27a4 C T 2: 29,702,944 (GRCm39) T591I probably null Het
Snx24 G T 18: 53,473,244 (GRCm39) V63F probably damaging Het
Spata31f1e T C 4: 42,792,923 (GRCm39) N403S possibly damaging Het
Sptbn1 A T 11: 30,067,798 (GRCm39) Y1805* probably null Het
Svep1 G A 4: 58,046,587 (GRCm39) Q3515* probably null Het
Synpo2 A C 3: 122,907,702 (GRCm39) M538R probably benign Het
Tfap2a T C 13: 40,874,784 (GRCm39) K276E probably damaging Het
Tmem158 C A 9: 123,089,366 (GRCm39) S82I probably damaging Het
Tmtc3 G T 10: 100,283,336 (GRCm39) H740N not run Het
Top3a A T 11: 60,638,974 (GRCm39) F559I probably damaging Het
Tysnd1 C A 10: 61,532,328 (GRCm39) P327T possibly damaging Het
Ulk4 T A 9: 120,974,125 (GRCm39) D969V probably benign Het
Vcan T A 13: 89,853,385 (GRCm39) Y525F probably benign Het
Vmn1r127 A G 7: 21,052,978 (GRCm39) F270S probably benign Het
Vmn1r204 G A 13: 22,740,975 (GRCm39) S202N probably damaging Het
Zfp280b C G 10: 75,874,537 (GRCm39) Q139E probably damaging Het
Zfp322a C A 13: 23,541,313 (GRCm39) G143V probably damaging Het
Zfp322a C T 13: 23,541,314 (GRCm39) G143S probably benign Het
Zfyve26 A T 12: 79,329,758 (GRCm39) V476D probably benign Het
Zkscan6 A T 11: 65,719,051 (GRCm39) H357L probably benign Het
Other mutations in Vmn2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Vmn2r107 APN 17 20,596,009 (GRCm39) missense probably damaging 0.98
IGL01768:Vmn2r107 APN 17 20,565,868 (GRCm39) missense probably benign 0.32
IGL02086:Vmn2r107 APN 17 20,578,062 (GRCm39) missense probably benign 0.00
IGL02136:Vmn2r107 APN 17 20,595,168 (GRCm39) missense probably benign 0.02
IGL02266:Vmn2r107 APN 17 20,577,039 (GRCm39) missense probably damaging 1.00
IGL02285:Vmn2r107 APN 17 20,595,823 (GRCm39) missense probably damaging 1.00
IGL02724:Vmn2r107 APN 17 20,577,006 (GRCm39) missense possibly damaging 0.49
IGL02998:Vmn2r107 APN 17 20,578,017 (GRCm39) missense probably damaging 0.99
IGL03089:Vmn2r107 APN 17 20,595,974 (GRCm39) missense probably benign 0.05
IGL03284:Vmn2r107 APN 17 20,577,173 (GRCm39) missense probably benign 0.07
IGL03307:Vmn2r107 APN 17 20,577,038 (GRCm39) missense probably benign 0.09
IGL03399:Vmn2r107 APN 17 20,578,220 (GRCm39) splice site probably benign
3-1:Vmn2r107 UTSW 17 20,565,766 (GRCm39) missense probably benign
BB006:Vmn2r107 UTSW 17 20,565,706 (GRCm39) missense probably null 0.96
BB016:Vmn2r107 UTSW 17 20,565,706 (GRCm39) missense probably null 0.96
R0285:Vmn2r107 UTSW 17 20,565,873 (GRCm39) missense probably benign 0.00
R0455:Vmn2r107 UTSW 17 20,595,085 (GRCm39) splice site probably benign
R0497:Vmn2r107 UTSW 17 20,595,394 (GRCm39) missense probably damaging 1.00
R0506:Vmn2r107 UTSW 17 20,578,021 (GRCm39) missense probably benign
R0621:Vmn2r107 UTSW 17 20,595,252 (GRCm39) missense probably benign 0.01
R0667:Vmn2r107 UTSW 17 20,575,916 (GRCm39) missense possibly damaging 0.91
R1118:Vmn2r107 UTSW 17 20,576,860 (GRCm39) missense probably benign 0.03
R1204:Vmn2r107 UTSW 17 20,578,031 (GRCm39) missense probably benign
R1237:Vmn2r107 UTSW 17 20,576,947 (GRCm39) nonsense probably null
R1485:Vmn2r107 UTSW 17 20,595,109 (GRCm39) missense possibly damaging 0.95
R1783:Vmn2r107 UTSW 17 20,576,775 (GRCm39) missense possibly damaging 0.51
R1873:Vmn2r107 UTSW 17 20,565,840 (GRCm39) missense probably benign 0.10
R1974:Vmn2r107 UTSW 17 20,575,879 (GRCm39) splice site probably null
R2009:Vmn2r107 UTSW 17 20,595,729 (GRCm39) missense probably benign 0.01
R2029:Vmn2r107 UTSW 17 20,595,549 (GRCm39) missense probably benign 0.01
R2164:Vmn2r107 UTSW 17 20,595,904 (GRCm39) missense probably damaging 1.00
R2269:Vmn2r107 UTSW 17 20,595,817 (GRCm39) missense possibly damaging 0.58
R3087:Vmn2r107 UTSW 17 20,580,607 (GRCm39) missense probably benign 0.03
R3740:Vmn2r107 UTSW 17 20,595,151 (GRCm39) missense probably benign 0.00
R3961:Vmn2r107 UTSW 17 20,595,717 (GRCm39) missense probably damaging 1.00
R4031:Vmn2r107 UTSW 17 20,595,483 (GRCm39) missense probably benign 0.00
R4270:Vmn2r107 UTSW 17 20,576,041 (GRCm39) missense probably benign
R4963:Vmn2r107 UTSW 17 20,595,403 (GRCm39) missense probably damaging 1.00
R5121:Vmn2r107 UTSW 17 20,576,015 (GRCm39) missense probably benign 0.01
R5640:Vmn2r107 UTSW 17 20,595,426 (GRCm39) missense probably damaging 1.00
R6007:Vmn2r107 UTSW 17 20,595,316 (GRCm39) missense probably benign 0.19
R6238:Vmn2r107 UTSW 17 20,565,849 (GRCm39) missense probably benign 0.43
R6298:Vmn2r107 UTSW 17 20,576,044 (GRCm39) missense probably benign 0.00
R6467:Vmn2r107 UTSW 17 20,595,939 (GRCm39) missense probably damaging 0.99
R6726:Vmn2r107 UTSW 17 20,595,637 (GRCm39) missense probably damaging 0.96
R6782:Vmn2r107 UTSW 17 20,577,141 (GRCm39) missense probably damaging 1.00
R7299:Vmn2r107 UTSW 17 20,565,878 (GRCm39) missense probably benign 0.01
R7375:Vmn2r107 UTSW 17 20,576,138 (GRCm39) missense probably benign
R7448:Vmn2r107 UTSW 17 20,595,994 (GRCm39) missense probably benign 0.00
R7495:Vmn2r107 UTSW 17 20,595,271 (GRCm39) missense possibly damaging 0.71
R7589:Vmn2r107 UTSW 17 20,595,634 (GRCm39) missense probably benign 0.05
R7594:Vmn2r107 UTSW 17 20,580,635 (GRCm39) missense probably benign 0.03
R7678:Vmn2r107 UTSW 17 20,576,901 (GRCm39) missense probably benign 0.01
R7929:Vmn2r107 UTSW 17 20,565,706 (GRCm39) missense probably null 0.96
R7974:Vmn2r107 UTSW 17 20,577,270 (GRCm39) missense probably benign 0.00
R8040:Vmn2r107 UTSW 17 20,595,808 (GRCm39) missense probably damaging 1.00
R8263:Vmn2r107 UTSW 17 20,580,614 (GRCm39) missense probably damaging 1.00
R8426:Vmn2r107 UTSW 17 20,577,239 (GRCm39) missense possibly damaging 0.91
R9175:Vmn2r107 UTSW 17 20,577,051 (GRCm39) missense possibly damaging 0.79
R9537:Vmn2r107 UTSW 17 20,595,149 (GRCm39) missense probably benign 0.00
R9642:Vmn2r107 UTSW 17 20,580,661 (GRCm39) missense probably damaging 1.00
R9711:Vmn2r107 UTSW 17 20,577,262 (GRCm39) missense probably damaging 1.00
X0022:Vmn2r107 UTSW 17 20,577,230 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACCAATGTGCTAATAGGATGTTCTC -3'
(R):5'- TTCCTCCTGAGTGTGGAATATAATC -3'

Sequencing Primer
(F):5'- GGATGTTCTCCTGGATTTTTATCTTC -3'
(R):5'- ATGGCTACACCCATTACG -3'
Posted On 2019-06-26