Incidental Mutation 'R7301:Cd2ap'
ID567016
Institutional Source Beutler Lab
Gene Symbol Cd2ap
Ensembl Gene ENSMUSG00000061665
Gene NameCD2-associated protein
SynonymsMets1, METS-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7301 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location42792951-42876424 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 42830013 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 212 (R212*)
Ref Sequence ENSEMBL: ENSMUSP00000024709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024709]
PDB Structure
Third SH3 domain of CD2AP [SOLUTION NMR]
RDC refined solution structure of the first SH3 domain of CD2AP [SOLUTION NMR]
High resolution structure of the second SH3 domain of CD2AP [SOLUTION NMR]
RDC refined high resolution structure of the third SH3 domain of CD2AP [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by sh3 domains: molecular determinants and functional implications [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000024709
AA Change: R212*
SMART Domains Protein: ENSMUSP00000024709
Gene: ENSMUSG00000061665
AA Change: R212*

DomainStartEndE-ValueType
SH3 2 58 4.48e-19 SMART
SH3 111 166 6.63e-22 SMART
low complexity region 183 195 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SH3 272 329 4.62e-21 SMART
low complexity region 336 352 N/A INTRINSIC
low complexity region 377 399 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
PDB:3LK4|9 475 503 2e-12 PDB
low complexity region 536 555 N/A INTRINSIC
coiled coil region 595 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a scaffolding molecule that regulates the actin cytoskeleton. The protein directly interacts with filamentous actin and a variety of cell membrane proteins through multiple actin binding sites, SH3 domains, and a proline-rich region containing binding sites for SH3 domains. The cytoplasmic protein localizes to membrane ruffles, lipid rafts, and the leading edges of cells. It is implicated in dynamic actin remodeling and membrane trafficking that occurs during receptor endocytosis and cytokinesis. The mouse genome contains at least two pseudogenes located on chromosomes 9 and 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired immune function and die at 6 to 7 weeks of age from kidney failure associated with podocyte defects and mesangial cell hyperplasia. Heterozygotes develop glomerular changes around 9 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,777,085 S345N possibly damaging Het
Agk A T 6: 40,329,517 T7S possibly damaging Het
Ankrd26 T C 6: 118,511,663 E1345G possibly damaging Het
Atp1a3 T A 7: 24,990,515 Y493F probably benign Het
Atxn2l G T 7: 126,494,211 Y791* probably null Het
Cacng8 C A 7: 3,415,421 T363K probably benign Het
Camkmt A G 17: 85,431,493 T216A probably benign Het
Cnppd1 A G 1: 75,136,424 L400P probably damaging Het
Csmd2 C A 4: 128,528,262 D2797E Het
Ddx24 A G 12: 103,419,450 M298T possibly damaging Het
Dpyd T C 3: 118,899,284 V359A possibly damaging Het
Dscam T C 16: 97,056,532 T93A probably benign Het
Eif2b3 T A 4: 117,052,822 S185T probably benign Het
Entpd2 T A 2: 25,400,909 I475N possibly damaging Het
Ercc2 C A 7: 19,394,135 Q715K probably benign Het
Fam122a T A 19: 24,477,124 H78L probably benign Het
Fam122a T A 19: 24,477,346 E4V probably damaging Het
Fam186b T C 15: 99,278,748 R754G probably benign Het
Fcgbp T A 7: 28,093,436 V955E possibly damaging Het
Frrs1 T C 3: 116,895,563 V361A possibly damaging Het
Gabrr2 T A 4: 33,095,284 M391K probably benign Het
Gm12394 T C 4: 42,792,923 N403S possibly damaging Het
Gm3409 T A 5: 146,539,547 D169E probably benign Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Greb1l C G 18: 10,544,970 Q1433E probably damaging Het
Hal T C 10: 93,492,561 V233A probably benign Het
Ighv1-58 A T 12: 115,312,295 N74K probably benign Het
Il12rb1 A G 8: 70,813,699 I229M possibly damaging Het
Il17rd T C 14: 27,076,391 I56T possibly damaging Het
Itpr1 T C 6: 108,542,024 V2708A possibly damaging Het
Klhl38 G A 15: 58,322,980 R118W probably damaging Het
Lmf2 C A 15: 89,355,530 probably benign Het
Lrrc3b T C 14: 15,357,934 Y224C probably damaging Het
Med1 A C 11: 98,152,808 F599C probably benign Het
Mrgprb4 A G 7: 48,198,758 S141P probably damaging Het
Mst1r G T 9: 107,914,790 A842S possibly damaging Het
Myo3a T C 2: 22,544,466 probably null Het
Nos1 A T 5: 117,867,905 D230V possibly damaging Het
Nppb T C 4: 147,986,323 S52P probably benign Het
Nqo1 A G 8: 107,392,648 I99T probably damaging Het
Olfr346 T A 2: 36,688,011 M3K probably benign Het
Olfr769 T C 10: 129,111,699 H242R probably damaging Het
Pcdha3 G A 18: 36,946,924 E240K possibly damaging Het
Plpp7 T G 2: 32,096,055 F82V probably benign Het
Podxl G T 6: 31,524,436 P395T probably damaging Het
Prr5l T A 2: 101,717,286 D298V probably damaging Het
Rad9b A G 5: 122,352,614 V13A possibly damaging Het
Rasl2-9 A G 7: 5,125,740 W64R probably damaging Het
Rilp G T 11: 75,510,116 probably benign Het
Ripor2 T C 13: 24,725,001 I1034T possibly damaging Het
Rtn4ip1 T C 10: 43,936,020 Y338H probably damaging Het
Shisa5 G T 9: 109,054,884 probably benign Het
Slc27a4 C T 2: 29,812,932 T591I probably null Het
Snx24 G T 18: 53,340,172 V63F probably damaging Het
Sptbn1 A T 11: 30,117,798 Y1805* probably null Het
Svep1 G A 4: 58,046,587 Q3515* probably null Het
Synpo2 A C 3: 123,114,053 M538R probably benign Het
Tfap2a T C 13: 40,721,308 K276E probably damaging Het
Tmem158 C A 9: 123,260,301 S82I probably damaging Het
Tmtc3 G T 10: 100,447,474 H740N not run Het
Top3a A T 11: 60,748,148 F559I probably damaging Het
Tysnd1 C A 10: 61,696,549 P327T possibly damaging Het
Ulk4 T A 9: 121,145,059 D969V probably benign Het
Vcan T A 13: 89,705,266 Y525F probably benign Het
Vmn1r127 A G 7: 21,319,053 F270S probably benign Het
Vmn1r204 G A 13: 22,556,805 S202N probably damaging Het
Vmn2r107 A G 17: 20,345,616 I64M probably benign Het
Zfp280b C G 10: 76,038,703 Q139E probably damaging Het
Zfp322a C A 13: 23,357,143 G143V probably damaging Het
Zfp322a C T 13: 23,357,144 G143S probably benign Het
Zfyve26 A T 12: 79,282,984 V476D probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Cd2ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Cd2ap APN 17 42808785 missense probably benign 0.16
IGL00909:Cd2ap APN 17 42830114 splice site probably benign
IGL01321:Cd2ap APN 17 42845389 missense possibly damaging 0.71
IGL01350:Cd2ap APN 17 42825921 nonsense probably null
IGL01485:Cd2ap APN 17 42852474 missense probably damaging 1.00
IGL01834:Cd2ap APN 17 42826360 critical splice acceptor site probably null
IGL01834:Cd2ap APN 17 42826361 critical splice acceptor site probably null
PIT4494001:Cd2ap UTSW 17 42852367 critical splice donor site probably null
R0014:Cd2ap UTSW 17 42807928 missense probably benign
R0331:Cd2ap UTSW 17 42805301 missense probably benign 0.06
R0674:Cd2ap UTSW 17 42845392 missense possibly damaging 0.89
R1471:Cd2ap UTSW 17 42820597 missense probably benign 0.00
R1806:Cd2ap UTSW 17 42838758 nonsense probably null
R3858:Cd2ap UTSW 17 42816572 nonsense probably null
R3911:Cd2ap UTSW 17 42816089 critical splice acceptor site probably null
R3941:Cd2ap UTSW 17 42808799 missense probably damaging 0.99
R4766:Cd2ap UTSW 17 42852459 missense probably damaging 0.99
R5024:Cd2ap UTSW 17 42805345 splice site probably null
R5045:Cd2ap UTSW 17 42807960 missense probably benign 0.01
R6051:Cd2ap UTSW 17 42796328 makesense probably null
R6063:Cd2ap UTSW 17 42825911 missense probably benign 0.00
R7034:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7036:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7214:Cd2ap UTSW 17 42845394 missense possibly damaging 0.61
R7299:Cd2ap UTSW 17 42830013 nonsense probably null
R7402:Cd2ap UTSW 17 42805163 missense possibly damaging 0.88
R7851:Cd2ap UTSW 17 42824472 critical splice donor site probably null
R7934:Cd2ap UTSW 17 42824472 critical splice donor site probably null
Z1088:Cd2ap UTSW 17 42807993 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAATCTGTGCTTACCTGAGC -3'
(R):5'- AGTGCTTGTCTCCTGAATTTCTTAG -3'

Sequencing Primer
(F):5'- TTGACTTCCCTCAATAACAGACTGAG -3'
(R):5'- CTCTAGGATGTTTGAGTGCCATG -3'
Posted On2019-06-26