Incidental Mutation 'R7302:Slc9a2'
ID567024
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7302 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40767668 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 705 (V705E)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000039672] [ENSMUST00000131390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027231
AA Change: V705E

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: V705E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039672
SMART Domains Protein: ENSMUSP00000035727
Gene: ENSMUSG00000041945

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Pfam:Sugar_tr 39 301 4.7e-8 PFAM
Pfam:MFS_1 39 419 1.8e-42 PFAM
low complexity region 436 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131390
SMART Domains Protein: ENSMUSP00000137884
Gene: ENSMUSG00000041945

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
low complexity region 36 46 N/A INTRINSIC
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,349 P69S probably benign Het
Adam17 A G 12: 21,355,693 probably benign Het
AI314180 T C 4: 58,834,593 K762E probably benign Het
Bcl7a T A 5: 123,344,694 M22K probably benign Het
C6 T A 15: 4,796,950 C672S probably damaging Het
Capn11 C T 17: 45,643,812 R133H probably damaging Het
Ccdc102a A G 8: 94,913,438 L76P probably damaging Het
Cotl1 T G 8: 119,810,301 I125L probably benign Het
Dennd5a A T 7: 109,905,699 M868K probably damaging Het
Depdc5 T C 5: 32,979,508 I1374T probably damaging Het
Dhx36 T C 3: 62,479,393 Y646C probably benign Het
Egln2 A G 7: 27,164,885 V205A probably damaging Het
Eri2 T A 7: 119,786,786 M229L probably benign Het
Fancf C A 7: 51,861,704 R184L probably damaging Het
Fancl A T 11: 26,403,363 E86D probably damaging Het
Fignl2 T C 15: 101,053,378 D341G unknown Het
Gm14410 A T 2: 177,193,855 H205Q probably damaging Het
Gm4788 T C 1: 139,739,698 probably null Het
Haus1 T C 18: 77,760,966 N181D probably benign Het
Hmbox1 T C 14: 64,828,666 Y285C probably damaging Het
Igkv3-9 A G 6: 70,588,755 M113V probably benign Het
Ivd T C 2: 118,871,504 V139A probably benign Het
Limch1 A T 5: 66,959,599 Y119F probably benign Het
Lrp1 C T 10: 127,538,987 R4534Q probably benign Het
Mbd3l2 G A 9: 18,444,442 S21N probably benign Het
Mob1b A G 5: 88,753,177 N148D probably benign Het
Mylk4 A T 13: 32,720,565 D195E probably benign Het
Ndufa7 T C 17: 33,829,713 S50P probably benign Het
Nectin4 G T 1: 171,386,635 E453* probably null Het
Nell1 T G 7: 50,856,269 F741L probably benign Het
Ntng1 T A 3: 109,832,617 H369L possibly damaging Het
Plin4 T A 17: 56,102,330 M1297L probably benign Het
Pnp G A 14: 50,950,947 V193M probably damaging Het
Ppp1r10 T G 17: 35,930,881 S849R unknown Het
Rpgrip1 A G 14: 52,149,555 E981G unknown Het
Sbsn T C 7: 30,751,884 F108S probably benign Het
Scn11a A G 9: 119,806,951 M310T probably benign Het
Sf3b1 A G 1: 55,016,790 S97P probably benign Het
Sgsh A G 11: 119,347,699 V313A probably benign Het
Slc25a10 G T 11: 120,491,956 probably benign Het
Surf2 G T 2: 26,918,882 C116F probably damaging Het
Tnks1bp1 T C 2: 85,052,354 I175T probably benign Het
Tnxb C T 17: 34,678,901 T841I probably benign Het
Ttll3 A G 6: 113,409,285 D693G probably damaging Het
Ust A G 10: 8,518,209 L64P probably damaging Het
Vmn1r77 C T 7: 12,042,056 S253F possibly damaging Het
Vmn2r66 A G 7: 85,005,215 M512T probably benign Het
Zfp13 C T 17: 23,581,062 G89D probably damaging Het
Zfp616 T A 11: 74,085,379 Y825N probably benign Het
Zfp865 A G 7: 5,029,253 Y79C possibly damaging Het
Zfyve26 A T 12: 79,251,168 F1916I probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40718909 missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
R7670:Slc9a2 UTSW 1 40718997 missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40726214 missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40718649 missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40742729 missense probably damaging 1.00
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40767711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTCAAGGTCACTCAGCTGG -3'
(R):5'- CAAACCGTTGGTCTTTGGAGAG -3'

Sequencing Primer
(F):5'- CTCAGCTGGAGTTAGAGTGAGATTTC -3'
(R):5'- CTTTGGAGAGCAGGGGC -3'
Posted On2019-06-26