Incidental Mutation 'R7302:Ttll3'
ID 567039
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7302 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 113389260-113414587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113409285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 693 (D693G)
Ref Sequence ENSEMBL: ENSMUSP00000032414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect probably damaging
Transcript: ENSMUST00000032414
AA Change: D693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: D693G

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038889
AA Change: D694G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: D694G

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,349 P69S probably benign Het
Adam17 A G 12: 21,355,693 probably benign Het
AI314180 T C 4: 58,834,593 K762E probably benign Het
Bcl7a T A 5: 123,344,694 M22K probably benign Het
C6 T A 15: 4,796,950 C672S probably damaging Het
Capn11 C T 17: 45,643,812 R133H probably damaging Het
Ccdc102a A G 8: 94,913,438 L76P probably damaging Het
Cotl1 T G 8: 119,810,301 I125L probably benign Het
Dennd5a A T 7: 109,905,699 M868K probably damaging Het
Depdc5 T C 5: 32,979,508 I1374T probably damaging Het
Dhx36 T C 3: 62,479,393 Y646C probably benign Het
Egln2 A G 7: 27,164,885 V205A probably damaging Het
Eri2 T A 7: 119,786,786 M229L probably benign Het
Fancf C A 7: 51,861,704 R184L probably damaging Het
Fancl A T 11: 26,403,363 E86D probably damaging Het
Fignl2 T C 15: 101,053,378 D341G unknown Het
Gm14410 A T 2: 177,193,855 H205Q probably damaging Het
Gm4788 T C 1: 139,739,698 probably null Het
Haus1 T C 18: 77,760,966 N181D probably benign Het
Hmbox1 T C 14: 64,828,666 Y285C probably damaging Het
Igkv3-9 A G 6: 70,588,755 M113V probably benign Het
Ivd T C 2: 118,871,504 V139A probably benign Het
Limch1 A T 5: 66,959,599 Y119F probably benign Het
Lrp1 C T 10: 127,538,987 R4534Q probably benign Het
Mbd3l2 G A 9: 18,444,442 S21N probably benign Het
Mob1b A G 5: 88,753,177 N148D probably benign Het
Mylk4 A T 13: 32,720,565 D195E probably benign Het
Ndufa7 T C 17: 33,829,713 S50P probably benign Het
Nectin4 G T 1: 171,386,635 E453* probably null Het
Nell1 T G 7: 50,856,269 F741L probably benign Het
Ntng1 T A 3: 109,832,617 H369L possibly damaging Het
Plin4 T A 17: 56,102,330 M1297L probably benign Het
Pnp G A 14: 50,950,947 V193M probably damaging Het
Ppp1r10 T G 17: 35,930,881 S849R unknown Het
Rpgrip1 A G 14: 52,149,555 E981G unknown Het
Sbsn T C 7: 30,751,884 F108S probably benign Het
Scn11a A G 9: 119,806,951 M310T probably benign Het
Sf3b1 A G 1: 55,016,790 S97P probably benign Het
Sgsh A G 11: 119,347,699 V313A probably benign Het
Slc25a10 G T 11: 120,491,956 probably benign Het
Slc9a2 T A 1: 40,767,668 V705E possibly damaging Het
Surf2 G T 2: 26,918,882 C116F probably damaging Het
Tnks1bp1 T C 2: 85,052,354 I175T probably benign Het
Tnxb C T 17: 34,678,901 T841I probably benign Het
Ust A G 10: 8,518,209 L64P probably damaging Het
Vmn1r77 C T 7: 12,042,056 S253F possibly damaging Het
Vmn2r66 A G 7: 85,005,215 M512T probably benign Het
Zfp13 C T 17: 23,581,062 G89D probably damaging Het
Zfp616 T A 11: 74,085,379 Y825N probably benign Het
Zfp865 A G 7: 5,029,253 Y79C possibly damaging Het
Zfyve26 A T 12: 79,251,168 F1916I probably damaging Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113412889 missense probably benign 0.00
R9036:Ttll3 UTSW 6 113399696 missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113392635 missense probably benign
R9271:Ttll3 UTSW 6 113392635 missense probably benign
R9329:Ttll3 UTSW 6 113392674 missense probably benign
R9532:Ttll3 UTSW 6 113409009 missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113412873 missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113409153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTGCTGTGATCCATGC -3'
(R):5'- GTCAGACCAGAGGAAGTGTCTG -3'

Sequencing Primer
(F):5'- TCCCAAGATAACGTGCAGTG -3'
(R):5'- CCAGAGGAAGTGTCTGTTTTAAGAC -3'
Posted On 2019-06-26