Incidental Mutation 'R7302:Egln2'
ID567042
Institutional Source Beutler Lab
Gene Symbol Egln2
Ensembl Gene ENSMUSG00000058709
Gene Nameegl-9 family hypoxia-inducible factor 2
SynonymsSM-20, Phd1, Ier4, 0610011A13Rik, Hif-p4h-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7302 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27158658-27166802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27164885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 205 (V205A)
Ref Sequence ENSEMBL: ENSMUSP00000078966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000093040] [ENSMUST00000108382] [ENSMUST00000153511] [ENSMUST00000154724]
Predicted Effect probably damaging
Transcript: ENSMUST00000080058
AA Change: V205A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709
AA Change: V205A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093040
SMART Domains Protein: ENSMUSP00000090727
Gene: ENSMUSG00000053291

DomainStartEndE-ValueType
RAB 9 172 2.47e-101 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108382
AA Change: V205A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709
AA Change: V205A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153511
SMART Domains Protein: ENSMUSP00000138477
Gene: ENSMUSG00000053291

DomainStartEndE-ValueType
Pfam:Arf 3 97 1.8e-11 PFAM
Pfam:Miro 10 95 9.5e-15 PFAM
Pfam:Ras 10 95 7.8e-35 PFAM
Pfam:Gtr1_RagA 10 98 4.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154724
SMART Domains Protein: ENSMUSP00000122859
Gene: ENSMUSG00000095538

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SH3 46 112 8.92e-5 SMART
Meta Mutation Damage Score 0.6510 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes are viable with no apparent abnormalities in cardiovascular, hematopoietic, or placental morphology and development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,349 P69S probably benign Het
Adam17 A G 12: 21,355,693 probably benign Het
AI314180 T C 4: 58,834,593 K762E probably benign Het
Bcl7a T A 5: 123,344,694 M22K probably benign Het
C6 T A 15: 4,796,950 C672S probably damaging Het
Capn11 C T 17: 45,643,812 R133H probably damaging Het
Ccdc102a A G 8: 94,913,438 L76P probably damaging Het
Cotl1 T G 8: 119,810,301 I125L probably benign Het
Dennd5a A T 7: 109,905,699 M868K probably damaging Het
Depdc5 T C 5: 32,979,508 I1374T probably damaging Het
Dhx36 T C 3: 62,479,393 Y646C probably benign Het
Eri2 T A 7: 119,786,786 M229L probably benign Het
Fancf C A 7: 51,861,704 R184L probably damaging Het
Fancl A T 11: 26,403,363 E86D probably damaging Het
Fignl2 T C 15: 101,053,378 D341G unknown Het
Gm14410 A T 2: 177,193,855 H205Q probably damaging Het
Gm4788 T C 1: 139,739,698 probably null Het
Haus1 T C 18: 77,760,966 N181D probably benign Het
Hmbox1 T C 14: 64,828,666 Y285C probably damaging Het
Igkv3-9 A G 6: 70,588,755 M113V probably benign Het
Ivd T C 2: 118,871,504 V139A probably benign Het
Limch1 A T 5: 66,959,599 Y119F probably benign Het
Lrp1 C T 10: 127,538,987 R4534Q probably benign Het
Mbd3l2 G A 9: 18,444,442 S21N probably benign Het
Mob1b A G 5: 88,753,177 N148D probably benign Het
Mylk4 A T 13: 32,720,565 D195E probably benign Het
Ndufa7 T C 17: 33,829,713 S50P probably benign Het
Nectin4 G T 1: 171,386,635 E453* probably null Het
Nell1 T G 7: 50,856,269 F741L probably benign Het
Ntng1 T A 3: 109,832,617 H369L possibly damaging Het
Plin4 T A 17: 56,102,330 M1297L probably benign Het
Pnp G A 14: 50,950,947 V193M probably damaging Het
Ppp1r10 T G 17: 35,930,881 S849R unknown Het
Rpgrip1 A G 14: 52,149,555 E981G unknown Het
Sbsn T C 7: 30,751,884 F108S probably benign Het
Scn11a A G 9: 119,806,951 M310T probably benign Het
Sf3b1 A G 1: 55,016,790 S97P probably benign Het
Sgsh A G 11: 119,347,699 V313A probably benign Het
Slc25a10 G T 11: 120,491,956 probably benign Het
Slc9a2 T A 1: 40,767,668 V705E possibly damaging Het
Surf2 G T 2: 26,918,882 C116F probably damaging Het
Tnks1bp1 T C 2: 85,052,354 I175T probably benign Het
Tnxb C T 17: 34,678,901 T841I probably benign Het
Ttll3 A G 6: 113,409,285 D693G probably damaging Het
Ust A G 10: 8,518,209 L64P probably damaging Het
Vmn1r77 C T 7: 12,042,056 S253F possibly damaging Het
Vmn2r66 A G 7: 85,005,215 M512T probably benign Het
Zfp13 C T 17: 23,581,062 G89D probably damaging Het
Zfp616 T A 11: 74,085,379 Y825N probably benign Het
Zfp865 A G 7: 5,029,253 Y79C possibly damaging Het
Zfyve26 A T 12: 79,251,168 F1916I probably damaging Het
Other mutations in Egln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Egln2 APN 7 27160292 missense probably null 0.03
IGL01975:Egln2 APN 7 27160320 missense possibly damaging 0.50
IGL02261:Egln2 APN 7 27159866 missense possibly damaging 0.78
R0268:Egln2 UTSW 7 27165247 missense possibly damaging 0.57
R1276:Egln2 UTSW 7 27165005 unclassified probably benign
R1455:Egln2 UTSW 7 27160371 missense probably damaging 1.00
R4569:Egln2 UTSW 7 27159583 missense probably damaging 1.00
R4656:Egln2 UTSW 7 27159193 missense probably benign 0.00
R7201:Egln2 UTSW 7 27160319 missense probably damaging 1.00
R7216:Egln2 UTSW 7 27159829 missense probably damaging 1.00
Z1177:Egln2 UTSW 7 27164990 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTGCGCCCATTGATGAC -3'
(R):5'- AAAGTGGTATGGGCTGTGAC -3'

Sequencing Primer
(F):5'- ATTACTGCGTCCACGTGAG -3'
(R):5'- TGTGACAGCGGTGCCAG -3'
Posted On2019-06-26