Incidental Mutation 'R7302:Slc25a10'
ID567058
Institutional Source Beutler Lab
Gene Symbol Slc25a10
Ensembl Gene ENSMUSG00000025792
Gene Namesolute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
SynonymsDic
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7302 (G1)
Quality Score90.0077
Status Validated
Chromosome11
Chromosomal Location120491840-120499187 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 120491956 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026899] [ENSMUST00000043627]
Predicted Effect probably benign
Transcript: ENSMUST00000026899
SMART Domains Protein: ENSMUSP00000026899
Gene: ENSMUSG00000025792

DomainStartEndE-ValueType
Pfam:Mito_carr 5 92 4.1e-20 PFAM
Pfam:Mito_carr 94 191 2e-18 PFAM
Pfam:Mito_carr 195 284 7.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043627
SMART Domains Protein: ENSMUSP00000044417
Gene: ENSMUSG00000039640

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
Pfam:Ribosomal_L12_N 64 120 4.5e-13 PFAM
Pfam:Ribosomal_L12 133 201 5.4e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,349 P69S probably benign Het
Adam17 A G 12: 21,355,693 probably benign Het
AI314180 T C 4: 58,834,593 K762E probably benign Het
Bcl7a T A 5: 123,344,694 M22K probably benign Het
C6 T A 15: 4,796,950 C672S probably damaging Het
Capn11 C T 17: 45,643,812 R133H probably damaging Het
Ccdc102a A G 8: 94,913,438 L76P probably damaging Het
Cotl1 T G 8: 119,810,301 I125L probably benign Het
Dennd5a A T 7: 109,905,699 M868K probably damaging Het
Depdc5 T C 5: 32,979,508 I1374T probably damaging Het
Dhx36 T C 3: 62,479,393 Y646C probably benign Het
Egln2 A G 7: 27,164,885 V205A probably damaging Het
Eri2 T A 7: 119,786,786 M229L probably benign Het
Fancf C A 7: 51,861,704 R184L probably damaging Het
Fancl A T 11: 26,403,363 E86D probably damaging Het
Fignl2 T C 15: 101,053,378 D341G unknown Het
Gm14410 A T 2: 177,193,855 H205Q probably damaging Het
Gm4788 T C 1: 139,739,698 probably null Het
Haus1 T C 18: 77,760,966 N181D probably benign Het
Hmbox1 T C 14: 64,828,666 Y285C probably damaging Het
Igkv3-9 A G 6: 70,588,755 M113V probably benign Het
Ivd T C 2: 118,871,504 V139A probably benign Het
Limch1 A T 5: 66,959,599 Y119F probably benign Het
Lrp1 C T 10: 127,538,987 R4534Q probably benign Het
Mbd3l2 G A 9: 18,444,442 S21N probably benign Het
Mob1b A G 5: 88,753,177 N148D probably benign Het
Mylk4 A T 13: 32,720,565 D195E probably benign Het
Ndufa7 T C 17: 33,829,713 S50P probably benign Het
Nectin4 G T 1: 171,386,635 E453* probably null Het
Nell1 T G 7: 50,856,269 F741L probably benign Het
Ntng1 T A 3: 109,832,617 H369L possibly damaging Het
Plin4 T A 17: 56,102,330 M1297L probably benign Het
Pnp G A 14: 50,950,947 V193M probably damaging Het
Ppp1r10 T G 17: 35,930,881 S849R unknown Het
Rpgrip1 A G 14: 52,149,555 E981G unknown Het
Sbsn T C 7: 30,751,884 F108S probably benign Het
Scn11a A G 9: 119,806,951 M310T probably benign Het
Sf3b1 A G 1: 55,016,790 S97P probably benign Het
Sgsh A G 11: 119,347,699 V313A probably benign Het
Slc9a2 T A 1: 40,767,668 V705E possibly damaging Het
Surf2 G T 2: 26,918,882 C116F probably damaging Het
Tnks1bp1 T C 2: 85,052,354 I175T probably benign Het
Tnxb C T 17: 34,678,901 T841I probably benign Het
Ttll3 A G 6: 113,409,285 D693G probably damaging Het
Ust A G 10: 8,518,209 L64P probably damaging Het
Vmn1r77 C T 7: 12,042,056 S253F possibly damaging Het
Vmn2r66 A G 7: 85,005,215 M512T probably benign Het
Zfp13 C T 17: 23,581,062 G89D probably damaging Het
Zfp616 T A 11: 74,085,379 Y825N probably benign Het
Zfp865 A G 7: 5,029,253 Y79C possibly damaging Het
Zfyve26 A T 12: 79,251,168 F1916I probably damaging Het
Other mutations in Slc25a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc25a10 APN 11 120497107 critical splice donor site probably null
IGL00816:Slc25a10 APN 11 120495150 splice site probably benign
IGL02448:Slc25a10 APN 11 120497053 missense probably benign 0.01
R2291:Slc25a10 UTSW 11 120497074 missense probably benign
R2860:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R2861:Slc25a10 UTSW 11 120495177 missense probably damaging 0.98
R3938:Slc25a10 UTSW 11 120491993 nonsense probably null
R4019:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4020:Slc25a10 UTSW 11 120497439 missense probably damaging 0.99
R4457:Slc25a10 UTSW 11 120497089 missense probably benign
R4542:Slc25a10 UTSW 11 120497981 splice site probably null
R5643:Slc25a10 UTSW 11 120496376 intron probably benign
R5869:Slc25a10 UTSW 11 120498117 missense probably damaging 0.98
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6032:Slc25a10 UTSW 11 120494958 critical splice acceptor site probably null
R6455:Slc25a10 UTSW 11 120495205 missense probably damaging 1.00
R6574:Slc25a10 UTSW 11 120497077 missense probably benign
R6954:Slc25a10 UTSW 11 120498147 missense probably benign
R7618:Slc25a10 UTSW 11 120496971 intron probably null
R7671:Slc25a10 UTSW 11 120495460 missense probably benign 0.18
R7883:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
R7966:Slc25a10 UTSW 11 120494514 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCGTTGCGGCCTCTTTAAGAC -3'
(R):5'- TAATTACCGGGTGCGCAGTC -3'

Sequencing Primer
(F):5'- TTGCGGCCTCTTTAAGACCAGAG -3'
(R):5'- AGCAGGCGCCTTGTAGG -3'
Posted On2019-06-26