Incidental Mutation 'R7302:Mylk4'
ID567060
Institutional Source Beutler Lab
Gene Symbol Mylk4
Ensembl Gene ENSMUSG00000044951
Gene Namemyosin light chain kinase family, member 4
SynonymsEG238564
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7302 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location32700834-32783954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32720565 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 195 (D195E)
Ref Sequence ENSEMBL: ENSMUSP00000060149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057428] [ENSMUST00000230119]
Predicted Effect probably benign
Transcript: ENSMUST00000057428
AA Change: D195E

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060149
Gene: ENSMUSG00000044951
AA Change: D195E

DomainStartEndE-ValueType
S_TKc 107 362 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230119
AA Change: D426E

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,349 P69S probably benign Het
Adam17 A G 12: 21,355,693 probably benign Het
AI314180 T C 4: 58,834,593 K762E probably benign Het
Bcl7a T A 5: 123,344,694 M22K probably benign Het
C6 T A 15: 4,796,950 C672S probably damaging Het
Capn11 C T 17: 45,643,812 R133H probably damaging Het
Ccdc102a A G 8: 94,913,438 L76P probably damaging Het
Cotl1 T G 8: 119,810,301 I125L probably benign Het
Dennd5a A T 7: 109,905,699 M868K probably damaging Het
Depdc5 T C 5: 32,979,508 I1374T probably damaging Het
Dhx36 T C 3: 62,479,393 Y646C probably benign Het
Egln2 A G 7: 27,164,885 V205A probably damaging Het
Eri2 T A 7: 119,786,786 M229L probably benign Het
Fancf C A 7: 51,861,704 R184L probably damaging Het
Fancl A T 11: 26,403,363 E86D probably damaging Het
Fignl2 T C 15: 101,053,378 D341G unknown Het
Gm14410 A T 2: 177,193,855 H205Q probably damaging Het
Gm4788 T C 1: 139,739,698 probably null Het
Haus1 T C 18: 77,760,966 N181D probably benign Het
Hmbox1 T C 14: 64,828,666 Y285C probably damaging Het
Igkv3-9 A G 6: 70,588,755 M113V probably benign Het
Ivd T C 2: 118,871,504 V139A probably benign Het
Limch1 A T 5: 66,959,599 Y119F probably benign Het
Lrp1 C T 10: 127,538,987 R4534Q probably benign Het
Mbd3l2 G A 9: 18,444,442 S21N probably benign Het
Mob1b A G 5: 88,753,177 N148D probably benign Het
Ndufa7 T C 17: 33,829,713 S50P probably benign Het
Nectin4 G T 1: 171,386,635 E453* probably null Het
Nell1 T G 7: 50,856,269 F741L probably benign Het
Ntng1 T A 3: 109,832,617 H369L possibly damaging Het
Plin4 T A 17: 56,102,330 M1297L probably benign Het
Pnp G A 14: 50,950,947 V193M probably damaging Het
Ppp1r10 T G 17: 35,930,881 S849R unknown Het
Rpgrip1 A G 14: 52,149,555 E981G unknown Het
Sbsn T C 7: 30,751,884 F108S probably benign Het
Scn11a A G 9: 119,806,951 M310T probably benign Het
Sf3b1 A G 1: 55,016,790 S97P probably benign Het
Sgsh A G 11: 119,347,699 V313A probably benign Het
Slc25a10 G T 11: 120,491,956 probably benign Het
Slc9a2 T A 1: 40,767,668 V705E possibly damaging Het
Surf2 G T 2: 26,918,882 C116F probably damaging Het
Tnks1bp1 T C 2: 85,052,354 I175T probably benign Het
Tnxb C T 17: 34,678,901 T841I probably benign Het
Ttll3 A G 6: 113,409,285 D693G probably damaging Het
Ust A G 10: 8,518,209 L64P probably damaging Het
Vmn1r77 C T 7: 12,042,056 S253F possibly damaging Het
Vmn2r66 A G 7: 85,005,215 M512T probably benign Het
Zfp13 C T 17: 23,581,062 G89D probably damaging Het
Zfp616 T A 11: 74,085,379 Y825N probably benign Het
Zfp865 A G 7: 5,029,253 Y79C possibly damaging Het
Zfyve26 A T 12: 79,251,168 F1916I probably damaging Het
Other mutations in Mylk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Mylk4 APN 13 32715922 missense probably damaging 1.00
IGL01799:Mylk4 APN 13 32781691 missense probably benign 0.00
IGL01985:Mylk4 APN 13 32717581 missense possibly damaging 0.81
IGL02105:Mylk4 APN 13 32720562 missense probably benign 0.17
IGL02270:Mylk4 APN 13 32729066 splice site probably benign
IGL02377:Mylk4 APN 13 32722147 missense possibly damaging 0.69
IGL03142:Mylk4 APN 13 32720599 missense probably damaging 1.00
R0550:Mylk4 UTSW 13 32716666 missense probably benign 0.00
R0599:Mylk4 UTSW 13 32712754 unclassified probably null
R1070:Mylk4 UTSW 13 32724818 missense probably benign 0.05
R1520:Mylk4 UTSW 13 32712838 unclassified probably null
R1658:Mylk4 UTSW 13 32712789 missense possibly damaging 0.77
R1917:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1918:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R1919:Mylk4 UTSW 13 32724853 missense probably benign 0.00
R2187:Mylk4 UTSW 13 32722013 missense probably damaging 0.97
R2568:Mylk4 UTSW 13 32722018 missense probably null 0.97
R4832:Mylk4 UTSW 13 32721977 missense probably benign 0.04
R5268:Mylk4 UTSW 13 32708881 unclassified probably null
R6801:Mylk4 UTSW 13 32728410 missense probably benign 0.07
R6894:Mylk4 UTSW 13 32722015 missense probably damaging 1.00
R7329:Mylk4 UTSW 13 32716783 missense probably damaging 1.00
R7634:Mylk4 UTSW 13 32708908 missense possibly damaging 0.88
R7702:Mylk4 UTSW 13 32720602 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTACATCATATTTCACAGGTCCCC -3'
(R):5'- GGAAATAACTGTGCACGTGTG -3'

Sequencing Primer
(F):5'- CCCCAACAGTGTGACAGAGG -3'
(R):5'- GCATGGGCACGCACACAC -3'
Posted On2019-06-26