Incidental Mutation 'R0636:Gnl3'
ID56708
Institutional Source Beutler Lab
Gene Symbol Gnl3
Ensembl Gene ENSMUSG00000042354
Gene Nameguanine nucleotide binding protein-like 3 (nucleolar)
Synonymsnucleostemin, NS
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31012433-31019152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31017153 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 75 (K75N)
Ref Sequence ENSEMBL: ENSMUSP00000047119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037739] [ENSMUST00000052239] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000112106] [ENSMUST00000144009] [ENSMUST00000146325] [ENSMUST00000226740] [ENSMUST00000227467] [ENSMUST00000228341]
Predicted Effect probably damaging
Transcript: ENSMUST00000037739
AA Change: K75N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047119
Gene: ENSMUSG00000042354
AA Change: K75N

DomainStartEndE-ValueType
Pfam:GN3L_Grn1 16 90 4.3e-25 PFAM
low complexity region 112 126 N/A INTRINSIC
SCOP:d1egaa1 130 207 3e-3 SMART
low complexity region 209 220 N/A INTRINSIC
Pfam:MMR_HSR1 251 362 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052239
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104609
Predicted Effect probably benign
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112106
SMART Domains Protein: ENSMUSP00000107734
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 61 91 6e-16 BLAST
PDB:3IU5|A 61 91 6e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000144009
SMART Domains Protein: ENSMUSP00000123518
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
Blast:BROMO 40 68 8e-14 BLAST
PDB:3IU5|A 64 84 8e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145497
Predicted Effect probably benign
Transcript: ENSMUST00000146325
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226220
Predicted Effect probably benign
Transcript: ENSMUST00000226379
Predicted Effect probably damaging
Transcript: ENSMUST00000226740
AA Change: K75N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227389
Predicted Effect probably damaging
Transcript: ENSMUST00000227467
AA Change: K63N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227869
Predicted Effect unknown
Transcript: ENSMUST00000228341
AA Change: K29N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228774
Meta Mutation Damage Score 0.1570 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene leads to early embryonic loss as blastocysts fail to enter the S phase. MEFs heterozygous for a gene trap allele have reduced proliferative capacity while MEFs heterozygous for a null allele show reduced doubling rates,increased apoptosis and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Gnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Gnl3 APN 14 31014189 missense possibly damaging 0.71
IGL00826:Gnl3 APN 14 31012796 unclassified probably benign
IGL02323:Gnl3 APN 14 31017402 missense probably damaging 1.00
R0277:Gnl3 UTSW 14 31013427 critical splice donor site probably null
R0727:Gnl3 UTSW 14 31017077 missense probably damaging 0.99
R1459:Gnl3 UTSW 14 31017846 missense probably damaging 1.00
R1474:Gnl3 UTSW 14 31016461 splice site probably benign
R2016:Gnl3 UTSW 14 31016369 unclassified probably null
R2352:Gnl3 UTSW 14 31016826 critical splice donor site probably null
R2517:Gnl3 UTSW 14 31014163 missense probably damaging 1.00
R4115:Gnl3 UTSW 14 31016856 missense probably damaging 1.00
R4697:Gnl3 UTSW 14 31017329 missense probably damaging 0.98
R4853:Gnl3 UTSW 14 31015313 missense probably damaging 0.99
R4973:Gnl3 UTSW 14 31013505 missense possibly damaging 0.68
R5091:Gnl3 UTSW 14 31016846 missense possibly damaging 0.76
R5580:Gnl3 UTSW 14 31015285 missense probably benign
R5914:Gnl3 UTSW 14 31016896 missense possibly damaging 0.85
R6898:Gnl3 UTSW 14 31013179 missense probably benign 0.01
R7292:Gnl3 UTSW 14 31013232 missense probably benign
R7372:Gnl3 UTSW 14 31016886 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACGTTTTGTTACTCCCAAGGAACGC -3'
(R):5'- TGGCATCTTTACAGAGAGCTGCAAC -3'

Sequencing Primer
(F):5'- CGCAAGTTTTAAGGAAAGATAACC -3'
(R):5'- ACCCAGGTGTTCCAAATAGTG -3'
Posted On2013-07-11