Incidental Mutation 'R7303:Pepd'
ID567100
Institutional Source Beutler Lab
Gene Symbol Pepd
Ensembl Gene ENSMUSG00000063931
Gene Namepeptidase D
SynonymsPep4, Pep-4, dal, peptidase D
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location34912379-35044708 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35021772 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075068] [ENSMUST00000075068] [ENSMUST00000075068]
Predicted Effect probably null
Transcript: ENSMUST00000075068
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075068
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075068
SMART Domains Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931

DomainStartEndE-ValueType
AMP_N 18 155 2.71e-39 SMART
Pfam:Peptidase_M24 193 459 5.4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161900
SMART Domains Protein: ENSMUSP00000133634
Gene: ENSMUSG00000063931

DomainStartEndE-ValueType
Blast:AMP_N 2 35 3e-15 BLAST
PDB:2OKN|B 2 76 1e-43 PDB
SCOP:d1b6a_2 7 77 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Aldh16a1 A T 7: 45,147,904 L160Q probably damaging Het
Ang A T 14: 51,101,516 H38L probably benign Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mapkapk5 T C 5: 121,540,574 E13G probably benign Het
Mark3 T C 12: 111,655,536 V704A probably damaging Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr1087 A G 2: 86,690,822 V51A probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Spef2 T A 15: 9,647,490 I944F possibly damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Pepd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pepd APN 7 34924440 missense probably benign
IGL02102:Pepd APN 7 34945603 missense probably damaging 1.00
R1256:Pepd UTSW 7 34921492 missense possibly damaging 0.95
R1690:Pepd UTSW 7 35031357 missense probably damaging 1.00
R1734:Pepd UTSW 7 35031426 missense probably benign 0.07
R1911:Pepd UTSW 7 34934749 splice site probably benign
R1918:Pepd UTSW 7 34971676 missense probably benign 0.00
R2144:Pepd UTSW 7 34921418 missense probably benign 0.09
R4814:Pepd UTSW 7 34945597 missense probably damaging 0.96
R4924:Pepd UTSW 7 35020984 missense probably benign 0.24
R5490:Pepd UTSW 7 34942690 splice site probably null
R5669:Pepd UTSW 7 35040674 missense probably benign 0.38
R6240:Pepd UTSW 7 35021751 missense probably benign 0.00
R6300:Pepd UTSW 7 34969543 missense probably damaging 1.00
R6479:Pepd UTSW 7 35040722 missense probably benign 0.00
R6995:Pepd UTSW 7 35021719 missense probably damaging 1.00
R7587:Pepd UTSW 7 34969540 missense probably damaging 1.00
R8008:Pepd UTSW 7 35021701 missense probably benign 0.22
X0021:Pepd UTSW 7 34954563 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGAAGGCAGCTATTAGACC -3'
(R):5'- GCCTGGAGAAGTTGGCATTC -3'

Sequencing Primer
(F):5'- TTTCTGTCAGGCAGGAACAC -3'
(R):5'- TTCAGGCTGACAGCTATAGC -3'
Posted On2019-06-26