Incidental Mutation 'R7303:Aldh16a1'
ID567102
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Namealdehyde dehydrogenase 16 family, member A1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45140684-45154584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45147904 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 160 (L160Q)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209957] [ENSMUST00000209963] [ENSMUST00000210125] [ENSMUST00000211169] [ENSMUST00000211362]
Predicted Effect probably damaging
Transcript: ENSMUST00000107815
AA Change: L160Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833
AA Change: L160Q

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209957
Predicted Effect probably damaging
Transcript: ENSMUST00000209963
AA Change: L160Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210125
Predicted Effect probably benign
Transcript: ENSMUST00000211169
Predicted Effect probably benign
Transcript: ENSMUST00000211362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Ang A T 14: 51,101,516 H38L probably benign Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mapkapk5 T C 5: 121,540,574 E13G probably benign Het
Mark3 T C 12: 111,655,536 V704A probably damaging Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr1087 A G 2: 86,690,822 V51A probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pepd T C 7: 35,021,772 probably null Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Spef2 T A 15: 9,647,490 I944F possibly damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 45145513 missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 45141967 missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 45142093 missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 45146035 missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 45145594 missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 45141975 missense possibly damaging 0.85
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 45144664 missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 45147979 missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 45142838 missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 45146229 unclassified probably null
R0707:Aldh16a1 UTSW 7 45144507 unclassified probably benign
R0801:Aldh16a1 UTSW 7 45147476 missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 45142047 unclassified probably null
R1371:Aldh16a1 UTSW 7 45147250 missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 45147308 missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 45147161 critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 45148788 intron probably benign
R4859:Aldh16a1 UTSW 7 45147307 missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 45142069 missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 45144652 missense probably null 0.82
R5647:Aldh16a1 UTSW 7 45154465 missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 45147799 missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 45154407 unclassified probably benign
R5879:Aldh16a1 UTSW 7 45147506 nonsense probably null
R5890:Aldh16a1 UTSW 7 45144545 missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 45149765 missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 45141961 missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 45146271 missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 45144937 missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 45143227 missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 45145594 missense probably damaging 0.98
R7467:Aldh16a1 UTSW 7 45145907 missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 45147531 missense unknown
R7830:Aldh16a1 UTSW 7 45146225 missense probably damaging 0.98
Z1177:Aldh16a1 UTSW 7 45145903 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGCACCAGAGACTTTACCTAC -3'
(R):5'- ATAGTCCAGGCTGCTCTGAG -3'

Sequencing Primer
(F):5'- GAGACTTTACCTACCCATAGCCAAGG -3'
(R):5'- ACGACAACTCTGTGTTCTCTGAAGG -3'
Posted On2019-06-26