Incidental Mutation 'R7303:Mark3'
ID567123
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R7303 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111655536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 704 (V704A)
Ref Sequence ENSEMBL: ENSMUSP00000074757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953] [ENSMUST00000221459] [ENSMUST00000221753]
Predicted Effect probably damaging
Transcript: ENSMUST00000075281
AA Change: V704A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411
AA Change: V704A

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084953
AA Change: V719A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411
AA Change: V719A

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221459
AA Change: V728A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221753
AA Change: V772A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik G C 8: 84,161,233 G71A probably benign Het
Abca3 T G 17: 24,398,521 L1064R possibly damaging Het
Abca7 A T 10: 80,014,988 D2051V probably benign Het
Abcb5 T A 12: 118,911,560 I626F probably damaging Het
Abcg5 A G 17: 84,670,346 S333P probably damaging Het
Abl2 T C 1: 156,641,250 S695P probably benign Het
Aen C T 7: 78,902,456 P55S possibly damaging Het
Afg3l1 G T 8: 123,501,269 A598S probably damaging Het
Aldh16a1 A T 7: 45,147,904 L160Q probably damaging Het
Ang A T 14: 51,101,516 H38L probably benign Het
Ankar A T 1: 72,659,033 I954N probably benign Het
Aox2 A T 1: 58,334,765 K862* probably null Het
Cad T C 5: 31,060,213 probably null Het
Cc2d2b A T 19: 40,808,994 Y740F unknown Het
Ccdc182 T C 11: 88,294,216 Y41H probably benign Het
Chd9 A G 8: 91,051,904 R2848G unknown Het
Chrna6 A T 8: 27,406,991 L286* probably null Het
Cracr2b A G 7: 141,463,202 probably benign Het
Fam184b C T 5: 45,542,226 probably null Het
Fam208a A G 14: 27,471,852 E1003G probably damaging Het
Flnc T C 6: 29,460,850 S2647P probably benign Het
Ftsj3 T C 11: 106,254,680 D76G probably damaging Het
Fxyd1 T A 7: 31,054,318 M17L probably benign Het
Golim4 G A 3: 75,878,053 S677L probably damaging Het
Gpr149 A G 3: 62,595,070 V455A possibly damaging Het
H2-Q1 C A 17: 35,321,336 S132R probably benign Het
H2-Q7 A G 17: 35,440,061 I163V probably benign Het
Herc1 A T 9: 66,450,816 D2393V possibly damaging Het
Hmgb2 A G 8: 57,512,728 K44E possibly damaging Het
Itgad A G 7: 128,190,179 D605G probably benign Het
Kbtbd12 G T 6: 88,614,112 F16L unknown Het
Klhl23 T C 2: 69,824,701 I305T probably benign Het
Lrguk A T 6: 34,029,476 N7I probably benign Het
Lrp5 A G 19: 3,591,774 L1396P probably damaging Het
Mapkapk5 T C 5: 121,540,574 E13G probably benign Het
Mast2 A G 4: 116,308,311 S1303P possibly damaging Het
Mcm2 T C 6: 88,887,946 D516G probably damaging Het
Mon2 A T 10: 123,038,459 probably null Het
Mrc2 T A 11: 105,325,803 N139K probably damaging Het
Myh14 C T 7: 44,611,701 E1789K probably damaging Het
Myh7b T A 2: 155,618,740 L271Q probably damaging Het
Odf3l2 G A 10: 79,642,691 P80S probably benign Het
Olfr1087 A G 2: 86,690,822 V51A probably benign Het
Olfr61 T C 7: 140,638,354 S218P probably damaging Het
Oog2 A T 4: 144,195,342 H274L probably benign Het
Oosp1 A C 19: 11,668,410 S121R probably benign Het
Pepd T C 7: 35,021,772 probably null Het
Pik3c2a A C 7: 116,405,943 S363R probably benign Het
Polr2b T C 5: 77,321,021 Y215H probably benign Het
Ppcdc A T 9: 57,414,675 V194E probably benign Het
Rabgap1l A C 1: 160,682,097 I470S probably benign Het
Scgb1b3 G A 7: 31,375,958 A78T probably benign Het
Slc9a5 T A 8: 105,356,713 L368Q probably damaging Het
Spef2 T A 15: 9,647,490 I944F possibly damaging Het
Syne1 T A 10: 5,256,805 H3461L probably benign Het
Tas2r134 A G 2: 51,628,133 Y208C probably benign Het
Tm9sf3 G A 19: 41,238,759 S291F probably damaging Het
Tra2a G A 6: 49,250,987 T69I unknown Het
Ube2q1 T A 3: 89,776,591 L171Q possibly damaging Het
Ufd1 A G 16: 18,817,965 T78A probably damaging Het
Vmn1r13 T C 6: 57,210,602 S249P probably damaging Het
Wdr91 G A 6: 34,884,323 S648L probably benign Het
Zfp51 T A 17: 21,463,796 N224K probably benign Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111618397 splice site probably benign
R1305:Mark3 UTSW 12 111615446 critical splice donor site probably null
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4394:Mark3 UTSW 12 111604523 missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5060:Mark3 UTSW 12 111618326 missense probably damaging 0.98
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5813:Mark3 UTSW 12 111655443 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7408:Mark3 UTSW 12 111633789 missense probably damaging 0.99
R7454:Mark3 UTSW 12 111604527 missense probably damaging 1.00
R7680:Mark3 UTSW 12 111646773 missense probably benign 0.01
R8194:Mark3 UTSW 12 111592683 missense probably damaging 1.00
R8243:Mark3 UTSW 12 111647522 missense possibly damaging 0.73
R8385:Mark3 UTSW 12 111655374 missense possibly damaging 0.68
R8788:Mark3 UTSW 12 111646690 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTCTTCAGAGCAGAAGG -3'
(R):5'- GAAGATGCAGACGTTATTGCC -3'

Sequencing Primer
(F):5'- GCTTCACCTGGAGCATGAAGAC -3'
(R):5'- TGCAGACGTTATTGCCTAAATATTAC -3'
Posted On2019-06-26