Incidental Mutation 'R7304:Dido1'
ID 567146
Institutional Source Beutler Lab
Gene Symbol Dido1
Ensembl Gene ENSMUSG00000038914
Gene Name death inducer-obliterator 1
Synonyms D130048F08Rik, Datf1, 6720461J16Rik, dido, DIO-1, C130092D22Rik
MMRRC Submission 045365-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7304 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180299757-180351792 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 180329286 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 379 (L379F)
Ref Sequence ENSEMBL: ENSMUSP00000084794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087517] [ENSMUST00000103055] [ENSMUST00000103056] [ENSMUST00000103057] [ENSMUST00000130986]
AlphaFold Q8C9B9
Predicted Effect probably damaging
Transcript: ENSMUST00000087517
AA Change: L379F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084794
Gene: ENSMUSG00000038914
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 1e-22 PFAM
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1279 1308 N/A INTRINSIC
low complexity region 1372 1391 N/A INTRINSIC
coiled coil region 1458 1502 N/A INTRINSIC
low complexity region 1649 1680 N/A INTRINSIC
low complexity region 1748 1766 N/A INTRINSIC
low complexity region 1780 1792 N/A INTRINSIC
low complexity region 1804 1815 N/A INTRINSIC
internal_repeat_2 1816 1852 3.9e-5 PROSPERO
internal_repeat_1 1819 1859 6.92e-7 PROSPERO
internal_repeat_2 1926 1964 3.9e-5 PROSPERO
internal_repeat_1 1940 1982 6.92e-7 PROSPERO
low complexity region 2025 2045 N/A INTRINSIC
low complexity region 2123 2160 N/A INTRINSIC
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2182 2239 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103055
AA Change: L379F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099344
Gene: ENSMUSG00000038914
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103056
AA Change: L379F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099345
Gene: ENSMUSG00000038914
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103057
AA Change: L379F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099346
Gene: ENSMUSG00000038914
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130986
AA Change: L379F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119689
Gene: ENSMUSG00000038914
AA Change: L379F

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
Meta Mutation Damage Score 0.1780 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a transcription factor involved in apoptosis. The encoded protein functions in cell cycle progression and plays a role in chromosomal stability. This protein regulates the self-renewal of embryonic stem cells. Disruption of this gene in mice causes symptoms similar to myelodysplastic/myeloproliferative diseases in humans. Mice lacking this gene show severely reduced fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severely reduced fertility; about one-half develop a transplantable disease characterized by anomalies in spleen, bone marrow, and peripheral blood and including anemia and various symptoms typical of myeloid dysplasia or myeloid proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(245) : Targeted, knock-out(1) Gene trapped(244)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,247,203 (GRCm39) S2317G probably benign Het
Acap2 A C 16: 30,926,934 (GRCm39) L502R probably benign Het
Amotl2 A G 9: 102,605,549 (GRCm39) E467G probably damaging Het
Apbb1ip A T 2: 22,743,147 (GRCm39) probably null Het
Armc9 C G 1: 86,090,437 (GRCm39) D77E probably benign Het
Art1 T A 7: 101,755,531 (GRCm39) S8T possibly damaging Het
Asic5 G A 3: 81,916,872 (GRCm39) A321T possibly damaging Het
Astn2 A G 4: 66,103,612 (GRCm39) I267T unknown Het
Bmp8a T C 4: 123,236,182 (GRCm39) N107S probably benign Het
Card14 T A 11: 119,228,573 (GRCm39) L633Q probably damaging Het
Chpf C T 1: 75,455,698 (GRCm39) V18M possibly damaging Het
Cog7 T C 7: 121,536,362 (GRCm39) I493V probably benign Het
Col3a1 A T 1: 45,386,971 (GRCm39) N1394I unknown Het
Crybg1 C T 10: 43,873,254 (GRCm39) D1285N probably benign Het
Depdc7 A G 2: 104,553,463 (GRCm39) V395A possibly damaging Het
Dnajc13 G T 9: 104,115,713 (GRCm39) T32N probably benign Het
Dok2 T A 14: 71,013,468 (GRCm39) S133R probably benign Het
Ehbp1l1 C T 19: 5,766,410 (GRCm39) R1311H probably damaging Het
Gm3099 A T 14: 15,346,488 (GRCm39) N118I probably damaging Het
Gtse1 A G 15: 85,755,748 (GRCm39) T471A probably benign Het
Heg1 G A 16: 33,581,160 (GRCm39) A13T possibly damaging Het
Ifi209 A T 1: 173,470,156 (GRCm39) Y248F possibly damaging Het
Irag1 T C 7: 110,498,931 (GRCm39) T367A possibly damaging Het
Itgb3bp C G 4: 99,657,758 (GRCm39) E169Q probably damaging Het
Kcna2 A G 3: 107,012,066 (GRCm39) T216A probably benign Het
Kcnj6 A T 16: 94,742,042 (GRCm39) M10K probably benign Het
Krt17 T G 11: 100,148,163 (GRCm39) Q397P probably benign Het
Lrtm1 T A 14: 28,744,075 (GRCm39) M181K probably damaging Het
Map3k5 A G 10: 19,975,301 (GRCm39) H741R probably damaging Het
Mier1 T A 4: 102,996,599 (GRCm39) Y120* probably null Het
Myh14 T A 7: 44,279,415 (GRCm39) T922S probably benign Het
Nfkbie A T 17: 45,871,067 (GRCm39) I240F possibly damaging Het
Npas3 C A 12: 54,115,824 (GRCm39) H915Q probably damaging Het
Nrg2 A T 18: 36,178,994 (GRCm39) V314E probably benign Het
Or2z9 T A 8: 72,854,190 (GRCm39) Y195* probably null Het
Pds5a T C 5: 65,777,077 (GRCm39) N28S probably damaging Het
Pira1 T C 7: 3,740,493 (GRCm39) T243A probably damaging Het
Pkhd1l1 A T 15: 44,361,878 (GRCm39) N517I possibly damaging Het
Plekhb1 T C 7: 100,294,874 (GRCm39) Y99C probably benign Het
Plpp6 T C 19: 28,941,617 (GRCm39) S73P probably benign Het
Polb T C 8: 23,129,975 (GRCm39) N199S probably benign Het
Ppp1r13b T C 12: 111,838,840 (GRCm39) N13D possibly damaging Het
Prorp A G 12: 55,351,429 (GRCm39) D246G probably damaging Het
Ptprn2 T A 12: 117,212,164 (GRCm39) V862D probably damaging Het
Rassf4 T C 6: 116,617,278 (GRCm39) I242M probably damaging Het
Rnf19a G A 15: 36,254,598 (GRCm39) T320I probably damaging Het
Sctr A T 1: 119,949,970 (GRCm39) E53V probably damaging Het
Srcin1 T C 11: 97,442,519 (GRCm39) D103G probably benign Het
St3gal3 T C 4: 117,814,633 (GRCm39) Q220R Het
Stk40 G A 4: 126,019,483 (GRCm39) E86K probably benign Het
Tas2r104 T A 6: 131,662,005 (GRCm39) I235F possibly damaging Het
Terf2ip T C 8: 112,738,280 (GRCm39) V56A possibly damaging Het
Thsd7b A G 1: 130,030,890 (GRCm39) N1075S probably benign Het
Trak1 A G 9: 121,245,278 (GRCm39) Y51C probably benign Het
Trav16n T A 14: 53,588,859 (GRCm39) V45E probably benign Het
Ttc6 T C 12: 57,622,837 (GRCm39) S79P probably damaging Het
Unc79 C T 12: 103,029,449 (GRCm39) T484M probably damaging Het
Usp49 T C 17: 47,983,796 (GRCm39) V267A possibly damaging Het
Vldlr T A 19: 27,216,004 (GRCm39) D305E possibly damaging Het
Vmn1r226 G T 17: 20,908,011 (GRCm39) C81F probably damaging Het
Vmn1r73 T C 7: 11,490,824 (GRCm39) V214A probably damaging Het
Vmn2r5 T C 3: 64,411,671 (GRCm39) N299S probably damaging Het
Vwa3b T C 1: 37,203,586 (GRCm39) L55S probably damaging Het
Wdr90 T C 17: 26,070,480 (GRCm39) D1105G probably benign Het
Zbtb38 A G 9: 96,569,480 (GRCm39) S535P probably damaging Het
Zfp329 T C 7: 12,544,826 (GRCm39) I233V probably damaging Het
Zfp579 T A 7: 4,997,582 (GRCm39) T110S probably benign Het
Other mutations in Dido1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dido1 APN 2 180,325,782 (GRCm39) missense probably benign
IGL00834:Dido1 APN 2 180,331,319 (GRCm39) missense possibly damaging 0.87
IGL01317:Dido1 APN 2 180,313,550 (GRCm39) missense probably benign 0.17
IGL01588:Dido1 APN 2 180,330,668 (GRCm39) missense probably benign 0.00
IGL01834:Dido1 APN 2 180,325,824 (GRCm39) splice site probably benign
IGL02102:Dido1 APN 2 180,304,040 (GRCm39) missense possibly damaging 0.58
IGL02556:Dido1 APN 2 180,331,128 (GRCm39) missense possibly damaging 0.69
IGL02756:Dido1 APN 2 180,303,716 (GRCm39) missense probably benign 0.00
IGL02826:Dido1 APN 2 180,325,751 (GRCm39) missense probably benign
IGL02970:Dido1 APN 2 180,331,208 (GRCm39) missense probably damaging 0.99
IGL03110:Dido1 APN 2 180,331,135 (GRCm39) missense probably damaging 1.00
IGL03116:Dido1 APN 2 180,312,772 (GRCm39) missense probably damaging 1.00
3370:Dido1 UTSW 2 180,313,335 (GRCm39) missense probably benign
A4554:Dido1 UTSW 2 180,317,164 (GRCm39) missense probably damaging 1.00
H8441:Dido1 UTSW 2 180,330,807 (GRCm39) missense probably benign 0.12
R0044:Dido1 UTSW 2 180,303,612 (GRCm39) missense probably damaging 1.00
R0044:Dido1 UTSW 2 180,303,612 (GRCm39) missense probably damaging 1.00
R0054:Dido1 UTSW 2 180,303,267 (GRCm39) missense probably benign 0.00
R0054:Dido1 UTSW 2 180,303,267 (GRCm39) missense probably benign 0.00
R0127:Dido1 UTSW 2 180,313,617 (GRCm39) missense probably benign 0.01
R0620:Dido1 UTSW 2 180,301,644 (GRCm39) missense probably benign 0.26
R0734:Dido1 UTSW 2 180,301,835 (GRCm39) missense probably benign 0.01
R1390:Dido1 UTSW 2 180,326,917 (GRCm39) missense possibly damaging 0.70
R1445:Dido1 UTSW 2 180,313,263 (GRCm39) missense possibly damaging 0.62
R1466:Dido1 UTSW 2 180,304,121 (GRCm39) missense probably damaging 1.00
R1466:Dido1 UTSW 2 180,304,121 (GRCm39) missense probably damaging 1.00
R1472:Dido1 UTSW 2 180,302,513 (GRCm39) missense probably benign 0.02
R1538:Dido1 UTSW 2 180,326,763 (GRCm39) missense possibly damaging 0.49
R1584:Dido1 UTSW 2 180,304,121 (GRCm39) missense probably damaging 1.00
R2020:Dido1 UTSW 2 180,301,378 (GRCm39) missense unknown
R2025:Dido1 UTSW 2 180,330,974 (GRCm39) nonsense probably null
R2026:Dido1 UTSW 2 180,330,974 (GRCm39) nonsense probably null
R2027:Dido1 UTSW 2 180,330,974 (GRCm39) nonsense probably null
R2089:Dido1 UTSW 2 180,303,677 (GRCm39) missense probably benign 0.29
R2091:Dido1 UTSW 2 180,303,677 (GRCm39) missense probably benign 0.29
R2091:Dido1 UTSW 2 180,303,677 (GRCm39) missense probably benign 0.29
R2495:Dido1 UTSW 2 180,331,181 (GRCm39) missense probably benign 0.00
R2931:Dido1 UTSW 2 180,303,446 (GRCm39) missense probably damaging 1.00
R3418:Dido1 UTSW 2 180,302,728 (GRCm39) missense possibly damaging 0.84
R3735:Dido1 UTSW 2 180,325,829 (GRCm39) splice site probably benign
R4523:Dido1 UTSW 2 180,314,085 (GRCm39) missense probably damaging 1.00
R4674:Dido1 UTSW 2 180,329,352 (GRCm39) missense probably damaging 0.97
R4729:Dido1 UTSW 2 180,329,443 (GRCm39) missense probably benign 0.00
R4762:Dido1 UTSW 2 180,331,368 (GRCm39) missense probably damaging 1.00
R4786:Dido1 UTSW 2 180,312,664 (GRCm39) missense possibly damaging 0.85
R4817:Dido1 UTSW 2 180,303,209 (GRCm39) missense probably benign 0.02
R4892:Dido1 UTSW 2 180,316,822 (GRCm39) nonsense probably null
R4979:Dido1 UTSW 2 180,302,606 (GRCm39) missense probably damaging 0.98
R5510:Dido1 UTSW 2 180,326,966 (GRCm39) missense probably benign 0.00
R5586:Dido1 UTSW 2 180,301,445 (GRCm39) nonsense probably null
R5672:Dido1 UTSW 2 180,313,696 (GRCm39) missense probably damaging 0.99
R5863:Dido1 UTSW 2 180,303,566 (GRCm39) missense probably benign 0.02
R5943:Dido1 UTSW 2 180,303,675 (GRCm39) missense probably benign 0.00
R5974:Dido1 UTSW 2 180,313,290 (GRCm39) missense probably benign 0.02
R6123:Dido1 UTSW 2 180,325,760 (GRCm39) missense probably benign 0.07
R6214:Dido1 UTSW 2 180,303,945 (GRCm39) missense probably damaging 1.00
R6215:Dido1 UTSW 2 180,303,945 (GRCm39) missense probably damaging 1.00
R6248:Dido1 UTSW 2 180,302,048 (GRCm39) missense probably damaging 1.00
R6285:Dido1 UTSW 2 180,302,940 (GRCm39) missense probably benign 0.00
R6349:Dido1 UTSW 2 180,302,494 (GRCm39) missense probably benign 0.03
R6437:Dido1 UTSW 2 180,316,806 (GRCm39) missense probably damaging 1.00
R6477:Dido1 UTSW 2 180,302,274 (GRCm39) missense probably benign 0.00
R6836:Dido1 UTSW 2 180,304,100 (GRCm39) missense probably benign 0.16
R7055:Dido1 UTSW 2 180,303,002 (GRCm39) missense probably benign 0.09
R7289:Dido1 UTSW 2 180,301,424 (GRCm39) missense unknown
R7343:Dido1 UTSW 2 180,316,914 (GRCm39) missense possibly damaging 0.49
R7363:Dido1 UTSW 2 180,304,310 (GRCm39) nonsense probably null
R7429:Dido1 UTSW 2 180,331,319 (GRCm39) missense possibly damaging 0.87
R7594:Dido1 UTSW 2 180,316,905 (GRCm39) missense probably benign
R7629:Dido1 UTSW 2 180,303,266 (GRCm39) missense probably benign
R7899:Dido1 UTSW 2 180,313,390 (GRCm39) missense possibly damaging 0.82
R7946:Dido1 UTSW 2 180,303,501 (GRCm39) missense possibly damaging 0.81
R7951:Dido1 UTSW 2 180,312,674 (GRCm39) missense probably benign 0.01
R8033:Dido1 UTSW 2 180,316,635 (GRCm39) missense probably damaging 1.00
R8069:Dido1 UTSW 2 180,302,705 (GRCm39) missense probably benign
R8331:Dido1 UTSW 2 180,302,242 (GRCm39) missense probably benign 0.00
R8479:Dido1 UTSW 2 180,315,022 (GRCm39) critical splice donor site probably null
R8936:Dido1 UTSW 2 180,303,195 (GRCm39) missense probably benign
R9089:Dido1 UTSW 2 180,303,293 (GRCm39) missense probably benign 0.00
R9647:Dido1 UTSW 2 180,315,068 (GRCm39) missense probably benign 0.00
R9648:Dido1 UTSW 2 180,302,468 (GRCm39) missense probably damaging 1.00
R9784:Dido1 UTSW 2 180,325,354 (GRCm39) missense probably benign 0.27
V1024:Dido1 UTSW 2 180,330,807 (GRCm39) missense probably benign 0.12
X0011:Dido1 UTSW 2 180,302,627 (GRCm39) missense probably benign 0.00
X0019:Dido1 UTSW 2 180,313,365 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACCAGCAGCAGAATGTTCTC -3'
(R):5'- AACGGGGAAGACTACATCTGC -3'

Sequencing Primer
(F):5'- CAGCAGCAGAATGTTCTCTTGCAG -3'
(R):5'- GCCCAAATTGCACCATTTTG -3'
Posted On 2019-06-26