Incidental Mutation 'R7304:Mier1'
ID 567152
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7304 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 103114390-103165754 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 103139402 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 120 (Y120*)
Ref Sequence ENSEMBL: ENSMUSP00000095558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
AlphaFold Q5UAK0
Predicted Effect probably null
Transcript: ENSMUST00000030247
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: Y92*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097945
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: Y120*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106857
AA Change: Y75*
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: Y75*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106858
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: Y92*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Crybg1 C T 10: 43,997,258 D1285N probably benign Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dnajc13 G T 9: 104,238,514 T32N probably benign Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Krt17 T G 11: 100,257,337 Q397P probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Myh14 T A 7: 44,629,991 T922S probably benign Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Olfr373 T A 8: 72,100,346 Y195* probably null Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zbtb38 A G 9: 96,687,427 S535P probably damaging Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103155572 missense probably damaging 0.99
IGL01599:Mier1 APN 4 103155541 missense possibly damaging 0.58
IGL01996:Mier1 APN 4 103127276 missense possibly damaging 0.93
IGL02228:Mier1 APN 4 103131062 missense possibly damaging 0.85
R0194:Mier1 UTSW 4 103139519 splice site probably null
R0505:Mier1 UTSW 4 103155623 splice site probably benign
R0684:Mier1 UTSW 4 103139434 missense probably damaging 0.99
R0691:Mier1 UTSW 4 103139502 missense probably benign 0.07
R2997:Mier1 UTSW 4 103131036 missense probably damaging 1.00
R4273:Mier1 UTSW 4 103162431 missense possibly damaging 0.93
R4728:Mier1 UTSW 4 103140205 missense probably damaging 1.00
R4769:Mier1 UTSW 4 103140220 missense probably benign 0.01
R4798:Mier1 UTSW 4 103130998 missense probably damaging 1.00
R5075:Mier1 UTSW 4 103139473 missense probably benign 0.02
R5260:Mier1 UTSW 4 103162710 missense probably benign 0.04
R5663:Mier1 UTSW 4 103150542 missense probably damaging 0.96
R5924:Mier1 UTSW 4 103159702 nonsense probably null
R7253:Mier1 UTSW 4 103139347 splice site probably null
R7641:Mier1 UTSW 4 103139440 missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103162615 missense probably benign 0.09
R8000:Mier1 UTSW 4 103131043 missense probably damaging 1.00
R8557:Mier1 UTSW 4 103139346 splice site probably null
R9353:Mier1 UTSW 4 103155603 missense probably damaging 0.97
R9537:Mier1 UTSW 4 103162561 missense probably benign 0.00
R9759:Mier1 UTSW 4 103162528 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGTGGTATATGGACTGAATAATGGC -3'
(R):5'- CTGTGGTTTCATTAATCCTACAGGG -3'

Sequencing Primer
(F):5'- GGCAAAAATTGTACGTGATTTCAAAC -3'
(R):5'- CAGGGATCTTGGAAAATAAATGTTCC -3'
Posted On 2019-06-26