Incidental Mutation 'R7304:Mier1'
ID 567152
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms 4933425I22Rik, 5830411K19Rik
MMRRC Submission 045365-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7304 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 102971587-103022951 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 102996599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 120 (Y120*)
Ref Sequence ENSEMBL: ENSMUSP00000095558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
AlphaFold Q5UAK0
Predicted Effect probably null
Transcript: ENSMUST00000030247
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: Y92*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097945
AA Change: Y120*
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: Y120*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106857
AA Change: Y75*
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: Y75*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106858
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: Y92*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,247,203 (GRCm39) S2317G probably benign Het
Acap2 A C 16: 30,926,934 (GRCm39) L502R probably benign Het
Amotl2 A G 9: 102,605,549 (GRCm39) E467G probably damaging Het
Apbb1ip A T 2: 22,743,147 (GRCm39) probably null Het
Armc9 C G 1: 86,090,437 (GRCm39) D77E probably benign Het
Art1 T A 7: 101,755,531 (GRCm39) S8T possibly damaging Het
Asic5 G A 3: 81,916,872 (GRCm39) A321T possibly damaging Het
Astn2 A G 4: 66,103,612 (GRCm39) I267T unknown Het
Bmp8a T C 4: 123,236,182 (GRCm39) N107S probably benign Het
Card14 T A 11: 119,228,573 (GRCm39) L633Q probably damaging Het
Chpf C T 1: 75,455,698 (GRCm39) V18M possibly damaging Het
Cog7 T C 7: 121,536,362 (GRCm39) I493V probably benign Het
Col3a1 A T 1: 45,386,971 (GRCm39) N1394I unknown Het
Crybg1 C T 10: 43,873,254 (GRCm39) D1285N probably benign Het
Depdc7 A G 2: 104,553,463 (GRCm39) V395A possibly damaging Het
Dido1 G A 2: 180,329,286 (GRCm39) L379F probably damaging Het
Dnajc13 G T 9: 104,115,713 (GRCm39) T32N probably benign Het
Dok2 T A 14: 71,013,468 (GRCm39) S133R probably benign Het
Ehbp1l1 C T 19: 5,766,410 (GRCm39) R1311H probably damaging Het
Gm3099 A T 14: 15,346,488 (GRCm39) N118I probably damaging Het
Gtse1 A G 15: 85,755,748 (GRCm39) T471A probably benign Het
Heg1 G A 16: 33,581,160 (GRCm39) A13T possibly damaging Het
Ifi209 A T 1: 173,470,156 (GRCm39) Y248F possibly damaging Het
Irag1 T C 7: 110,498,931 (GRCm39) T367A possibly damaging Het
Itgb3bp C G 4: 99,657,758 (GRCm39) E169Q probably damaging Het
Kcna2 A G 3: 107,012,066 (GRCm39) T216A probably benign Het
Kcnj6 A T 16: 94,742,042 (GRCm39) M10K probably benign Het
Krt17 T G 11: 100,148,163 (GRCm39) Q397P probably benign Het
Lrtm1 T A 14: 28,744,075 (GRCm39) M181K probably damaging Het
Map3k5 A G 10: 19,975,301 (GRCm39) H741R probably damaging Het
Myh14 T A 7: 44,279,415 (GRCm39) T922S probably benign Het
Nfkbie A T 17: 45,871,067 (GRCm39) I240F possibly damaging Het
Npas3 C A 12: 54,115,824 (GRCm39) H915Q probably damaging Het
Nrg2 A T 18: 36,178,994 (GRCm39) V314E probably benign Het
Or2z9 T A 8: 72,854,190 (GRCm39) Y195* probably null Het
Pds5a T C 5: 65,777,077 (GRCm39) N28S probably damaging Het
Pira1 T C 7: 3,740,493 (GRCm39) T243A probably damaging Het
Pkhd1l1 A T 15: 44,361,878 (GRCm39) N517I possibly damaging Het
Plekhb1 T C 7: 100,294,874 (GRCm39) Y99C probably benign Het
Plpp6 T C 19: 28,941,617 (GRCm39) S73P probably benign Het
Polb T C 8: 23,129,975 (GRCm39) N199S probably benign Het
Ppp1r13b T C 12: 111,838,840 (GRCm39) N13D possibly damaging Het
Prorp A G 12: 55,351,429 (GRCm39) D246G probably damaging Het
Ptprn2 T A 12: 117,212,164 (GRCm39) V862D probably damaging Het
Rassf4 T C 6: 116,617,278 (GRCm39) I242M probably damaging Het
Rnf19a G A 15: 36,254,598 (GRCm39) T320I probably damaging Het
Sctr A T 1: 119,949,970 (GRCm39) E53V probably damaging Het
Srcin1 T C 11: 97,442,519 (GRCm39) D103G probably benign Het
St3gal3 T C 4: 117,814,633 (GRCm39) Q220R Het
Stk40 G A 4: 126,019,483 (GRCm39) E86K probably benign Het
Tas2r104 T A 6: 131,662,005 (GRCm39) I235F possibly damaging Het
Terf2ip T C 8: 112,738,280 (GRCm39) V56A possibly damaging Het
Thsd7b A G 1: 130,030,890 (GRCm39) N1075S probably benign Het
Trak1 A G 9: 121,245,278 (GRCm39) Y51C probably benign Het
Trav16n T A 14: 53,588,859 (GRCm39) V45E probably benign Het
Ttc6 T C 12: 57,622,837 (GRCm39) S79P probably damaging Het
Unc79 C T 12: 103,029,449 (GRCm39) T484M probably damaging Het
Usp49 T C 17: 47,983,796 (GRCm39) V267A possibly damaging Het
Vldlr T A 19: 27,216,004 (GRCm39) D305E possibly damaging Het
Vmn1r226 G T 17: 20,908,011 (GRCm39) C81F probably damaging Het
Vmn1r73 T C 7: 11,490,824 (GRCm39) V214A probably damaging Het
Vmn2r5 T C 3: 64,411,671 (GRCm39) N299S probably damaging Het
Vwa3b T C 1: 37,203,586 (GRCm39) L55S probably damaging Het
Wdr90 T C 17: 26,070,480 (GRCm39) D1105G probably benign Het
Zbtb38 A G 9: 96,569,480 (GRCm39) S535P probably damaging Het
Zfp329 T C 7: 12,544,826 (GRCm39) I233V probably damaging Het
Zfp579 T A 7: 4,997,582 (GRCm39) T110S probably benign Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103,012,769 (GRCm39) missense probably damaging 0.99
IGL01599:Mier1 APN 4 103,012,738 (GRCm39) missense possibly damaging 0.58
IGL01996:Mier1 APN 4 102,984,473 (GRCm39) missense possibly damaging 0.93
IGL02228:Mier1 APN 4 102,988,259 (GRCm39) missense possibly damaging 0.85
R0194:Mier1 UTSW 4 102,996,716 (GRCm39) splice site probably null
R0505:Mier1 UTSW 4 103,012,820 (GRCm39) splice site probably benign
R0684:Mier1 UTSW 4 102,996,631 (GRCm39) missense probably damaging 0.99
R0691:Mier1 UTSW 4 102,996,699 (GRCm39) missense probably benign 0.07
R2997:Mier1 UTSW 4 102,988,233 (GRCm39) missense probably damaging 1.00
R4273:Mier1 UTSW 4 103,019,628 (GRCm39) missense possibly damaging 0.93
R4728:Mier1 UTSW 4 102,997,402 (GRCm39) missense probably damaging 1.00
R4769:Mier1 UTSW 4 102,997,417 (GRCm39) missense probably benign 0.01
R4798:Mier1 UTSW 4 102,988,195 (GRCm39) missense probably damaging 1.00
R5075:Mier1 UTSW 4 102,996,670 (GRCm39) missense probably benign 0.02
R5260:Mier1 UTSW 4 103,019,907 (GRCm39) missense probably benign 0.04
R5663:Mier1 UTSW 4 103,007,739 (GRCm39) missense probably damaging 0.96
R5924:Mier1 UTSW 4 103,016,899 (GRCm39) nonsense probably null
R7253:Mier1 UTSW 4 102,996,544 (GRCm39) splice site probably null
R7641:Mier1 UTSW 4 102,996,637 (GRCm39) missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103,019,812 (GRCm39) missense probably benign 0.09
R8000:Mier1 UTSW 4 102,988,240 (GRCm39) missense probably damaging 1.00
R8557:Mier1 UTSW 4 102,996,543 (GRCm39) splice site probably null
R9353:Mier1 UTSW 4 103,012,800 (GRCm39) missense probably damaging 0.97
R9537:Mier1 UTSW 4 103,019,758 (GRCm39) missense probably benign 0.00
R9759:Mier1 UTSW 4 103,019,725 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGTGGTATATGGACTGAATAATGGC -3'
(R):5'- CTGTGGTTTCATTAATCCTACAGGG -3'

Sequencing Primer
(F):5'- GGCAAAAATTGTACGTGATTTCAAAC -3'
(R):5'- CAGGGATCTTGGAAAATAAATGTTCC -3'
Posted On 2019-06-26