Incidental Mutation 'R7304:Myh14'
ID 567163
Institutional Source Beutler Lab
Gene Symbol Myh14
Ensembl Gene ENSMUSG00000030739
Gene Name myosin, heavy polypeptide 14
Synonyms NMHC II-C, 2400004E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7304 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44605803-44670843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44629991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 922 (T922S)
Ref Sequence ENSEMBL: ENSMUSP00000103531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048102] [ENSMUST00000107899] [ENSMUST00000107900] [ENSMUST00000207775]
AlphaFold Q6URW6
Predicted Effect probably benign
Transcript: ENSMUST00000048102
AA Change: T930S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046059
Gene: ENSMUSG00000030739
AA Change: T930S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Blast:MYSc 839 872 1e-12 BLAST
low complexity region 880 891 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1005 1013 N/A INTRINSIC
low complexity region 1021 1029 N/A INTRINSIC
low complexity region 1030 1041 N/A INTRINSIC
Pfam:Myosin_tail_1 1094 1951 9.3e-180 PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107899
AA Change: T922S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103531
Gene: ENSMUSG00000030739
AA Change: T922S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 797 N/A SMART
IQ 798 820 3.91e-4 SMART
Blast:MYSc 831 864 1e-12 BLAST
low complexity region 872 883 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 997 1005 N/A INTRINSIC
low complexity region 1013 1021 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Pfam:Myosin_tail_1 1086 1943 9e-180 PFAM
low complexity region 1947 1958 N/A INTRINSIC
low complexity region 1960 1989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107900
AA Change: T930S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103532
Gene: ENSMUSG00000030739
AA Change: T930S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Pfam:Myosin_tail_1 869 1949 N/A PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207775
AA Change: T963S

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and survive to adulthood with no apparent defects. About 30% of knock-in mice either heterozygous or homozygous for a single amino acid mutation exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Crybg1 C T 10: 43,997,258 D1285N probably benign Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dnajc13 G T 9: 104,238,514 T32N probably benign Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Krt17 T G 11: 100,257,337 Q397P probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mier1 T A 4: 103,139,402 Y120* probably null Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Olfr373 T A 8: 72,100,346 Y195* probably null Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zbtb38 A G 9: 96,687,427 S535P probably damaging Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Myh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Myh14 APN 7 44606292 unclassified probably benign
IGL01431:Myh14 APN 7 44614358 missense probably null 0.00
IGL01722:Myh14 APN 7 44643532 missense probably damaging 1.00
IGL01806:Myh14 APN 7 44657939 missense probably benign 0.19
IGL02034:Myh14 APN 7 44616293 missense possibly damaging 0.58
IGL02260:Myh14 APN 7 44611571 missense probably damaging 1.00
IGL02590:Myh14 APN 7 44624079 missense probably damaging 1.00
IGL02696:Myh14 APN 7 44665106 missense probably damaging 1.00
IGL02705:Myh14 APN 7 44608536 missense possibly damaging 0.66
IGL03193:Myh14 APN 7 44629945 missense possibly damaging 0.91
PIT4581001:Myh14 UTSW 7 44613482 missense probably benign 0.04
R0067:Myh14 UTSW 7 44623127 missense probably benign 0.05
R0083:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0108:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0152:Myh14 UTSW 7 44623181 missense probably damaging 1.00
R0369:Myh14 UTSW 7 44660950 missense probably damaging 1.00
R0552:Myh14 UTSW 7 44613681 missense probably damaging 1.00
R0699:Myh14 UTSW 7 44624971 missense possibly damaging 0.67
R0763:Myh14 UTSW 7 44665367 missense probably damaging 0.98
R1079:Myh14 UTSW 7 44630002 missense probably damaging 1.00
R1388:Myh14 UTSW 7 44665122 missense probably damaging 0.98
R1432:Myh14 UTSW 7 44616299 missense probably damaging 1.00
R1568:Myh14 UTSW 7 44611698 nonsense probably null
R1579:Myh14 UTSW 7 44655694 splice site probably null
R1598:Myh14 UTSW 7 44638394 missense probably damaging 0.96
R1848:Myh14 UTSW 7 44632429 missense probably damaging 0.98
R1869:Myh14 UTSW 7 44611643 missense possibly damaging 0.95
R1917:Myh14 UTSW 7 44657925 missense probably benign
R1933:Myh14 UTSW 7 44615348 missense probably benign 0.09
R1984:Myh14 UTSW 7 44639022 missense probably damaging 1.00
R2154:Myh14 UTSW 7 44652429 critical splice donor site probably null
R2190:Myh14 UTSW 7 44661063 missense probably damaging 1.00
R2217:Myh14 UTSW 7 44634376 missense probably damaging 1.00
R2239:Myh14 UTSW 7 44665183 missense probably damaging 1.00
R2918:Myh14 UTSW 7 44616263 missense possibly damaging 0.91
R4091:Myh14 UTSW 7 44632991 missense possibly damaging 0.93
R4110:Myh14 UTSW 7 44628550 missense probably benign 0.00
R4199:Myh14 UTSW 7 44615503 nonsense probably null
R4507:Myh14 UTSW 7 44629991 missense probably benign 0.00
R4539:Myh14 UTSW 7 44627054 missense probably damaging 1.00
R4550:Myh14 UTSW 7 44634433 missense probably damaging 1.00
R4673:Myh14 UTSW 7 44624330 missense probably damaging 1.00
R4768:Myh14 UTSW 7 44613675 missense probably benign 0.19
R4832:Myh14 UTSW 7 44625142 missense probably benign 0.31
R4853:Myh14 UTSW 7 44608448 missense probably damaging 1.00
R4901:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R4928:Myh14 UTSW 7 44635502 missense probably benign 0.00
R5070:Myh14 UTSW 7 44616248 missense possibly damaging 0.91
R5166:Myh14 UTSW 7 44628855 missense probably damaging 0.99
R5726:Myh14 UTSW 7 44643462 critical splice donor site probably null
R5786:Myh14 UTSW 7 44613463 missense probably benign 0.23
R5895:Myh14 UTSW 7 44606709 missense probably damaging 1.00
R5961:Myh14 UTSW 7 44623094 missense probably damaging 0.96
R6014:Myh14 UTSW 7 44625078 missense probably null
R6080:Myh14 UTSW 7 44655611 missense probably damaging 1.00
R6187:Myh14 UTSW 7 44627033 missense probably damaging 1.00
R6657:Myh14 UTSW 7 44637846 missense probably damaging 1.00
R6833:Myh14 UTSW 7 44624379 nonsense probably null
R6894:Myh14 UTSW 7 44633512 missense probably damaging 1.00
R6916:Myh14 UTSW 7 44629313 missense probably damaging 0.96
R6962:Myh14 UTSW 7 44657939 missense probably benign 0.36
R7066:Myh14 UTSW 7 44630755 missense possibly damaging 0.69
R7261:Myh14 UTSW 7 44624337 nonsense probably null
R7303:Myh14 UTSW 7 44611701 missense probably damaging 1.00
R7327:Myh14 UTSW 7 44611553 missense possibly damaging 0.53
R7380:Myh14 UTSW 7 44661042 missense probably damaging 1.00
R7570:Myh14 UTSW 7 44632426 missense probably benign 0.37
R7622:Myh14 UTSW 7 44632422 missense probably benign 0.25
R7681:Myh14 UTSW 7 44624148 missense possibly damaging 0.81
R7718:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R7910:Myh14 UTSW 7 44632395 missense probably damaging 1.00
R8054:Myh14 UTSW 7 44625127 missense probably damaging 0.97
R8088:Myh14 UTSW 7 44665496 start codon destroyed probably null 0.94
R8164:Myh14 UTSW 7 44625033 missense probably benign 0.01
R8260:Myh14 UTSW 7 44615376 missense probably damaging 1.00
R8299:Myh14 UTSW 7 44627048 missense probably damaging 1.00
R8410:Myh14 UTSW 7 44633483 missense probably damaging 1.00
R8723:Myh14 UTSW 7 44622983 missense probably damaging 1.00
R8853:Myh14 UTSW 7 44616254 missense probably benign 0.08
R8934:Myh14 UTSW 7 44657428 missense probably benign
R9169:Myh14 UTSW 7 44621857 missense possibly damaging 0.73
R9395:Myh14 UTSW 7 44625160 missense possibly damaging 0.66
X0026:Myh14 UTSW 7 44614394 missense probably benign 0.00
X0063:Myh14 UTSW 7 44624133 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44608515 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44638309 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTATCTGTGCTTTGGACCCTC -3'
(R):5'- CAACAGCAAGGTTACGGGTG -3'

Sequencing Primer
(F):5'- TTTGGACCCTCGGAGCTGAG -3'
(R):5'- GCTCAAGGGACAGGGTCTG -3'
Posted On 2019-06-26