Incidental Mutation 'R7304:Olfr373'
ID567169
Institutional Source Beutler Lab
Gene Symbol Olfr373
Ensembl Gene ENSMUSG00000061561
Gene Nameolfactory receptor 373
SynonymsMOR282-2, GA_x6K02T2NUPS-231686-232630, MOR282-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7304 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location72083177-72103084 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 72100346 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 195 (Y195*)
Ref Sequence ENSEMBL: ENSMUSP00000149853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074540] [ENSMUST00000213940] [ENSMUST00000215198]
Predicted Effect probably null
Transcript: ENSMUST00000074540
AA Change: Y195*
SMART Domains Protein: ENSMUSP00000074128
Gene: ENSMUSG00000061561
AA Change: Y195*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 253 6.5e-8 PFAM
Pfam:7tm_1 41 290 4.9e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213940
AA Change: Y195*
Predicted Effect probably null
Transcript: ENSMUST00000215198
AA Change: Y195*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Crybg1 C T 10: 43,997,258 D1285N probably benign Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dnajc13 G T 9: 104,238,514 T32N probably benign Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Krt17 T G 11: 100,257,337 Q397P probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mier1 T A 4: 103,139,402 Y120* probably null Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Myh14 T A 7: 44,629,991 T922S probably benign Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zbtb38 A G 9: 96,687,427 S535P probably damaging Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Olfr373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr373 APN 8 72100512 missense probably damaging 1.00
IGL02440:Olfr373 APN 8 72100530 missense probably damaging 1.00
IGL03403:Olfr373 APN 8 72100497 missense probably benign 0.00
R1099:Olfr373 UTSW 8 72100659 missense probably benign 0.00
R1418:Olfr373 UTSW 8 72100387 missense probably damaging 1.00
R1452:Olfr373 UTSW 8 72100176 nonsense probably null
R1621:Olfr373 UTSW 8 72100129 missense probably damaging 1.00
R2021:Olfr373 UTSW 8 72100086 missense possibly damaging 0.90
R4230:Olfr373 UTSW 8 72100344 missense probably damaging 1.00
R4290:Olfr373 UTSW 8 72099768 missense probably benign
R5035:Olfr373 UTSW 8 72100078 missense probably damaging 1.00
R6884:Olfr373 UTSW 8 72100501 missense probably benign 0.26
R6909:Olfr373 UTSW 8 72100528 missense possibly damaging 0.95
R7233:Olfr373 UTSW 8 72100056 missense probably benign
R7312:Olfr373 UTSW 8 72099949 missense probably damaging 1.00
R7701:Olfr373 UTSW 8 72100186 missense probably damaging 1.00
Z1088:Olfr373 UTSW 8 72100517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTACCAGGTGCTCATGAG -3'
(R):5'- CTGCCTGGGACCATGTATATG -3'

Sequencing Primer
(F):5'- TGCTCATGAGAAACCAAGTGTGTC -3'
(R):5'- CTGCCTGGGACCATGTATATGAATAC -3'
Posted On2019-06-26