Incidental Mutation 'R0636:Vps8'
ID56717
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene NameVPS8 CORVET complex subunit
Synonyms
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21423118-21644680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21434933 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 8 (E8G)
Ref Sequence ENSEMBL: ENSMUSP00000119311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923] [ENSMUST00000122235] [ENSMUST00000139473]
Predicted Effect probably benign
Transcript: ENSMUST00000096191
AA Change: E8G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000096192
AA Change: E8G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115397
AA Change: E8G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117598
AA Change: E8G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118923
AA Change: E8G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122235
AA Change: E8G
SMART Domains Protein: ENSMUSP00000112622
Gene: ENSMUSG00000033653
AA Change: E8G

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
WD40 184 225 2.66e0 SMART
WD40 228 269 5.5e1 SMART
low complexity region 371 386 N/A INTRINSIC
low complexity region 480 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139473
AA Change: E8G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1070 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Slc3a1 A T 17: 85,032,794 T215S possibly damaging Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 unclassified probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21470154 missense probably benign 0.00
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0605:Vps8 UTSW 16 21559337 missense probably benign 0.00
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R3944:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 unclassified probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 unclassified probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4975:Vps8 UTSW 16 21466469 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R5963:Vps8 UTSW 16 21470121 missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
R7195:Vps8 UTSW 16 21456282 missense probably damaging 1.00
R7206:Vps8 UTSW 16 21457421 missense probably damaging 1.00
R7403:Vps8 UTSW 16 21434972 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGCCTGCAAACAGATGACCAAGTG -3'
(R):5'- CCAGAGTGCCCTGTAAACGGTAAC -3'

Sequencing Primer
(F):5'- AATCTCATCAAGGGTGTCTCTG -3'
(R):5'- TGTGGGTCACTAAGCACAC -3'
Posted On2013-07-11