Mutagenetix > Incidental Mutation

Incidental Mutation 'R7304:Zbtb38'

567171

Institutional Source

Beutler Lab

Gene Symbol

Zbtb38

Ensembl Gene

ENSMUSG00000040433

Gene Name

zinc finger and BTB domain containing 38

Synonyms

CIBZ, A930014K01Rik, Zenon homolog

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.486) question?

Stock #

R7304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96682770-96752831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96687427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 535 (S535P)

Ref Sequence

ENSEMBL: ENSMUSP00000120040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]

AlphaFold

Q3LR78

Predicted Effect

probably damaging
Transcript: ENSMUST00000093798
AA Change: S535P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: S535P

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126066
AA Change: S535P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: S535P

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128269

SMART Domains

Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140121
AA Change: S535P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433
AA Change: S535P

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000152594
AA Change: S535P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: S535P

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Meta Mutation Damage Score

0.1668

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,304,644	D246G	probably damaging	Het
Abca13	A	G	11: 9,297,203	S2317G	probably benign	Het
Acap2	A	C	16: 31,108,116	L502R	probably benign	Het
Amotl2	A	G	9: 102,728,350	E467G	probably damaging	Het
Apbb1ip	A	T	2: 22,853,135		probably null	Het
Armc9	C	G	1: 86,162,715	D77E	probably benign	Het
Art1	T	A	7: 102,106,324	S8T	possibly damaging	Het
Asic5	G	A	3: 82,009,565	A321T	possibly damaging	Het
Astn2	A	G	4: 66,185,375	I267T	unknown	Het
Bmp8a	T	C	4: 123,342,389	N107S	probably benign	Het
Card14	T	A	11: 119,337,747	L633Q	probably damaging	Het
Chpf	C	T	1: 75,479,054	V18M	possibly damaging	Het
Cog7	T	C	7: 121,937,139	I493V	probably benign	Het
Col3a1	A	T	1: 45,347,811	N1394I	unknown	Het
Crybg1	C	T	10: 43,997,258	D1285N	probably benign	Het
Depdc7	A	G	2: 104,723,118	V395A	possibly damaging	Het
Dido1	G	A	2: 180,687,493	L379F	probably damaging	Het
Dnajc13	G	T	9: 104,238,514	T32N	probably benign	Het
Dok2	T	A	14: 70,776,028	S133R	probably benign	Het
Ehbp1l1	C	T	19: 5,716,382	R1311H	probably damaging	Het
Gm15922	T	C	7: 3,737,494	T243A	probably damaging	Het
Gm3099	A	T	14: 4,000,520	N118I	probably damaging	Het
Gtse1	A	G	15: 85,871,547	T471A	probably benign	Het
Heg1	G	A	16: 33,760,790	A13T	possibly damaging	Het
Ifi209	A	T	1: 173,642,590	Y248F	possibly damaging	Het
Itgb3bp	C	G	4: 99,769,521	E169Q	probably damaging	Het
Kcna2	A	G	3: 107,104,750	T216A	probably benign	Het
Kcnj6	A	T	16: 94,941,183	M10K	probably benign	Het
Krt17	T	G	11: 100,257,337	Q397P	probably benign	Het
Lrtm1	T	A	14: 29,022,118	M181K	probably damaging	Het
Map3k5	A	G	10: 20,099,555	H741R	probably damaging	Het
Mier1	T	A	4: 103,139,402	Y120*	probably null	Het
Mrvi1	T	C	7: 110,899,724	T367A	possibly damaging	Het
Myh14	T	A	7: 44,629,991	T922S	probably benign	Het
Nfkbie	A	T	17: 45,560,141	I240F	possibly damaging	Het
Npas3	C	A	12: 54,069,041	H915Q	probably damaging	Het
Nrg2	A	T	18: 36,045,941	V314E	probably benign	Het
Olfr373	T	A	8: 72,100,346	Y195*	probably null	Het
Pds5a	T	C	5: 65,619,734	N28S	probably damaging	Het
Pkhd1l1	A	T	15: 44,498,482	N517I	possibly damaging	Het
Plekhb1	T	C	7: 100,645,667	Y99C	probably benign	Het
Plpp6	T	C	19: 28,964,217	S73P	probably benign	Het
Polb	T	C	8: 22,639,959	N199S	probably benign	Het
Ppp1r13b	T	C	12: 111,872,406	N13D	possibly damaging	Het
Ptprn2	T	A	12: 117,248,544	V862D	probably damaging	Het
Rassf4	T	C	6: 116,640,317	I242M	probably damaging	Het
Rnf19a	G	A	15: 36,254,452	T320I	probably damaging	Het
Sctr	A	T	1: 120,022,240	E53V	probably damaging	Het
Srcin1	T	C	11: 97,551,693	D103G	probably benign	Het
St3gal3	T	C	4: 117,957,436	Q220R		Het
Stk40	G	A	4: 126,125,690	E86K	probably benign	Het
Tas2r104	T	A	6: 131,685,042	I235F	possibly damaging	Het
Terf2ip	T	C	8: 112,011,648	V56A	possibly damaging	Het
Thsd7b	A	G	1: 130,103,153	N1075S	probably benign	Het
Trak1	A	G	9: 121,416,212	Y51C	probably benign	Het
Trav16n	T	A	14: 53,351,402	V45E	probably benign	Het
Ttc6	T	C	12: 57,576,051	S79P	probably damaging	Het
Unc79	C	T	12: 103,063,190	T484M	probably damaging	Het
Usp49	T	C	17: 47,672,871	V267A	possibly damaging	Het
Vldlr	T	A	19: 27,238,604	D305E	possibly damaging	Het
Vmn1r226	G	T	17: 20,687,749	C81F	probably damaging	Het
Vmn1r73	T	C	7: 11,756,897	V214A	probably damaging	Het
Vmn2r5	T	C	3: 64,504,250	N299S	probably damaging	Het
Vwa3b	T	C	1: 37,164,505	L55S	probably damaging	Het
Wdr90	T	C	17: 25,851,506	D1105G	probably benign	Het
Zfp329	T	C	7: 12,810,899	I233V	probably damaging	Het
Zfp579	T	A	7: 4,994,583	T110S	probably benign	Het

Other mutations in Zbtb38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Zbtb38	APN	9	96687494	missense	probably damaging	1.00
IGL01895:Zbtb38	APN	9	96688408	missense	probably benign	0.00
IGL02513:Zbtb38	APN	9	96687073	missense	probably damaging	1.00
IGL02649:Zbtb38	APN	9	96686619	missense	probably damaging	0.96
IGL02938:Zbtb38	APN	9	96687174	missense	probably benign	0.11
PIT4131001:Zbtb38	UTSW	9	96686316	missense	probably damaging	1.00
R0048:Zbtb38	UTSW	9	96687676	missense	probably damaging	1.00
R0152:Zbtb38	UTSW	9	96686280	missense	probably damaging	1.00
R0158:Zbtb38	UTSW	9	96686940	missense	possibly damaging	0.46
R0519:Zbtb38	UTSW	9	96685773	missense	probably damaging	1.00
R0594:Zbtb38	UTSW	9	96685954	missense	probably damaging	1.00
R1556:Zbtb38	UTSW	9	96686991	missense	probably benign	0.26
R1698:Zbtb38	UTSW	9	96685462	missense	probably benign
R1772:Zbtb38	UTSW	9	96688041	missense	probably damaging	1.00
R1799:Zbtb38	UTSW	9	96688881	missense	probably damaging	1.00
R1837:Zbtb38	UTSW	9	96686995	missense	probably benign
R2446:Zbtb38	UTSW	9	96687646	missense	probably damaging	1.00
R3153:Zbtb38	UTSW	9	96688249	missense	probably benign	0.34
R3950:Zbtb38	UTSW	9	96687546	missense	probably damaging	1.00
R4240:Zbtb38	UTSW	9	96686102	small deletion	probably benign
R4630:Zbtb38	UTSW	9	96688851	missense	probably damaging	1.00
R4666:Zbtb38	UTSW	9	96688383	missense	probably damaging	1.00
R4732:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4733:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4824:Zbtb38	UTSW	9	96688201	missense	probably benign	0.06
R5006:Zbtb38	UTSW	9	96685651	missense	probably damaging	1.00
R5109:Zbtb38	UTSW	9	96687009	missense	probably damaging	0.99
R5251:Zbtb38	UTSW	9	96687108	missense	probably benign	0.43
R5396:Zbtb38	UTSW	9	96687643	missense	probably damaging	1.00
R5659:Zbtb38	UTSW	9	96687420	missense	probably damaging	1.00
R6249:Zbtb38	UTSW	9	96685992	missense	probably damaging	0.99
R6294:Zbtb38	UTSW	9	96687229	missense	probably benign	0.05
R6615:Zbtb38	UTSW	9	96686654	nonsense	probably null
R6625:Zbtb38	UTSW	9	96687313	missense	probably damaging	1.00
R6885:Zbtb38	UTSW	9	96686464	missense	probably damaging	1.00
R7675:Zbtb38	UTSW	9	96685541	missense	probably benign	0.00
R7823:Zbtb38	UTSW	9	96685976	nonsense	probably null
R7900:Zbtb38	UTSW	9	96688936	missense	probably damaging	1.00
R8077:Zbtb38	UTSW	9	96688100	missense	probably benign
R8432:Zbtb38	UTSW	9	96686238	missense	possibly damaging	0.68
R8802:Zbtb38	UTSW	9	96685570	missense	probably benign	0.13
R8930:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R8932:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R9008:Zbtb38	UTSW	9	96687047	missense	probably benign
R9347:Zbtb38	UTSW	9	96685596	missense	probably damaging	0.99
R9520:Zbtb38	UTSW	9	96686051	missense	probably damaging	0.99
R9568:Zbtb38	UTSW	9	96688891	missense	probably damaging	1.00
R9680:Zbtb38	UTSW	9	96688344	missense	probably benign	0.03
R9777:Zbtb38	UTSW	9	96688302	missense	possibly damaging	0.49
R9777:Zbtb38	UTSW	9	96688303	missense	probably damaging	0.96
R9790:Zbtb38	UTSW	9	96688647	missense	probably damaging	1.00
R9791:Zbtb38	UTSW	9	96688647	missense	probably damaging	1.00
X0066:Zbtb38	UTSW	9	96687612	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCTTTGCAGATTCGGAAC -3'
(R):5'- GCGGCATGCAAATGTTCACTC -3'

Sequencing Primer
(F):5'- ACGTATCAGGGGCAGATTCACC -3'
(R):5'- CATGCAAATGTTCACTCGTGGAG -3'

Posted On

2019-06-26