Incidental Mutation 'R7304:Zbtb38'
ID 567171
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Name zinc finger and BTB domain containing 38
Synonyms CIBZ, A930014K01Rik, Zenon homolog
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock # R7304 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 96682770-96752831 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96687427 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 535 (S535P)
Ref Sequence ENSEMBL: ENSMUSP00000120040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
AlphaFold Q3LR78
Predicted Effect probably damaging
Transcript: ENSMUST00000093798
AA Change: S535P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: S535P

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126066
AA Change: S535P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: S535P

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140121
AA Change: S535P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433
AA Change: S535P

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152594
AA Change: S535P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: S535P

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Meta Mutation Damage Score 0.1668 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Crybg1 C T 10: 43,997,258 D1285N probably benign Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dnajc13 G T 9: 104,238,514 T32N probably benign Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Krt17 T G 11: 100,257,337 Q397P probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mier1 T A 4: 103,139,402 Y120* probably null Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Myh14 T A 7: 44,629,991 T922S probably benign Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Olfr373 T A 8: 72,100,346 Y195* probably null Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96687494 missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96688408 missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96687073 missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96686619 missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96687174 missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96686316 missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96687676 missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96686280 missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96686940 missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96685773 missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96685954 missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96686991 missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96685462 missense probably benign
R1772:Zbtb38 UTSW 9 96688041 missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96688881 missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96686995 missense probably benign
R2446:Zbtb38 UTSW 9 96687646 missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96688249 missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96687546 missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96686102 small deletion probably benign
R4630:Zbtb38 UTSW 9 96688851 missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96688383 missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96688201 missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96685651 missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96687009 missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96687108 missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96687643 missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96687420 missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96685992 missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96687229 missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96686654 nonsense probably null
R6625:Zbtb38 UTSW 9 96687313 missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96686464 missense probably damaging 1.00
R7675:Zbtb38 UTSW 9 96685541 missense probably benign 0.00
R7823:Zbtb38 UTSW 9 96685976 nonsense probably null
R7900:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
R8077:Zbtb38 UTSW 9 96688100 missense probably benign
R8432:Zbtb38 UTSW 9 96686238 missense possibly damaging 0.68
R8802:Zbtb38 UTSW 9 96685570 missense probably benign 0.13
R8930:Zbtb38 UTSW 9 96686381 missense probably benign 0.04
R8932:Zbtb38 UTSW 9 96686381 missense probably benign 0.04
R9008:Zbtb38 UTSW 9 96687047 missense probably benign
R9347:Zbtb38 UTSW 9 96685596 missense probably damaging 0.99
R9520:Zbtb38 UTSW 9 96686051 missense probably damaging 0.99
R9568:Zbtb38 UTSW 9 96688891 missense probably damaging 1.00
R9680:Zbtb38 UTSW 9 96688344 missense probably benign 0.03
R9777:Zbtb38 UTSW 9 96688302 missense possibly damaging 0.49
R9777:Zbtb38 UTSW 9 96688303 missense probably damaging 0.96
R9790:Zbtb38 UTSW 9 96688647 missense probably damaging 1.00
R9791:Zbtb38 UTSW 9 96688647 missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96687612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTTGCAGATTCGGAAC -3'
(R):5'- GCGGCATGCAAATGTTCACTC -3'

Sequencing Primer
(F):5'- ACGTATCAGGGGCAGATTCACC -3'
(R):5'- CATGCAAATGTTCACTCGTGGAG -3'
Posted On 2019-06-26