Incidental Mutation 'R7304:Dnajc13'
ID567173
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene NameDnaJ heat shock protein family (Hsp40) member C13
SynonymsLOC382100, D030002L11Rik, Rme8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R7304 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104151282-104262930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104238514 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 32 (T32N)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
Predicted Effect probably benign
Transcript: ENSMUST00000035170
AA Change: T32N

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: T32N

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186788
AA Change: T32N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: T32N

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Crybg1 C T 10: 43,997,258 D1285N probably benign Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Krt17 T G 11: 100,257,337 Q397P probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mier1 T A 4: 103,139,402 Y120* probably null Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Myh14 T A 7: 44,629,991 T922S probably benign Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Olfr373 T A 8: 72,100,346 Y195* probably null Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zbtb38 A G 9: 96,687,427 S535P probably damaging Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATTCATCTTCAGGCTGAC -3'
(R):5'- ACCATGTTTGTCCAGAGGTC -3'

Sequencing Primer
(F):5'- AGGCTGACATTTCTCTTCTGAACTG -3'
(R):5'- GATCCCCTGGAATTGGAGTTACAC -3'
Posted On2019-06-26