Incidental Mutation 'R7304:Krt17'
ID567179
Institutional Source Beutler Lab
Gene Symbol Krt17
Ensembl Gene ENSMUSG00000035557
Gene Namekeratin 17
SynonymsKrt1-17, K17
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7304 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location100256217-100261029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100257337 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 397 (Q397P)
Ref Sequence ENSEMBL: ENSMUSP00000079699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080893]
Predicted Effect probably benign
Transcript: ENSMUST00000080893
AA Change: Q397P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079699
Gene: ENSMUSG00000035557
AA Change: Q397P

DomainStartEndE-ValueType
Filament 83 394 9.36e-177 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the type I keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin required for the normal growth of hair follicles and may act in psoriasis as an immunopathogenic autoantigen. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display age- and strain-dependent alopecia associated with frequent absence of vibrissae, increased hair fragility, abnormal hair cycling, altered hair follicle morphology, and apoptosis in matrix cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Crybg1 C T 10: 43,997,258 D1285N probably benign Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dnajc13 G T 9: 104,238,514 T32N probably benign Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mier1 T A 4: 103,139,402 Y120* probably null Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Myh14 T A 7: 44,629,991 T922S probably benign Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Olfr373 T A 8: 72,100,346 Y195* probably null Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zbtb38 A G 9: 96,687,427 S535P probably damaging Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Krt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Krt17 APN 11 100260631 missense probably damaging 1.00
IGL02291:Krt17 APN 11 100256493 missense probably benign 0.42
IGL03392:Krt17 APN 11 100259735 missense possibly damaging 0.73
R0189:Krt17 UTSW 11 100260619 missense possibly damaging 0.95
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0238:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R0239:Krt17 UTSW 11 100260878 nonsense probably null
R1448:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R1510:Krt17 UTSW 11 100257539 missense possibly damaging 0.69
R4029:Krt17 UTSW 11 100257523 missense probably damaging 1.00
R4235:Krt17 UTSW 11 100257868 missense possibly damaging 0.90
R4888:Krt17 UTSW 11 100256479 missense probably benign 0.06
R5281:Krt17 UTSW 11 100260701 nonsense probably null
R7213:Krt17 UTSW 11 100258530 missense probably benign 0.09
R7238:Krt17 UTSW 11 100257787 missense probably benign 0.19
R7438:Krt17 UTSW 11 100258465 missense probably damaging 1.00
R7796:Krt17 UTSW 11 100260872 missense probably benign 0.23
Z1176:Krt17 UTSW 11 100260923 missense probably benign 0.23
Z1177:Krt17 UTSW 11 100259196 missense probably damaging 1.00
Z1177:Krt17 UTSW 11 100259711 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCATGCCTTCAATCAGACC -3'
(R):5'- CCAGGAGTACAAGATCCTGCTG -3'

Sequencing Primer
(F):5'- TCTGAGCATCAATTCTGAGCC -3'
(R):5'- TCCTGCTGGATGTGAAGACAAG -3'
Posted On2019-06-26