Mutagenetix > Incidental Mutations

Incidental Mutation 'R7304:Ttc6'

567183

Institutional Source

Beutler Lab

Gene Symbol

Ttc6

Ensembl Gene

ENSMUSG00000046782

Gene Name

tetratricopeptide repeat domain 6

Synonyms

EG639426, LOC217602, Gm9813

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R7304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57564113-57737928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57576051 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 79 (S79P)

Ref Sequence

ENSEMBL: ENSMUSP00000098946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101398] [ENSMUST00000172939]

Predicted Effect

probably damaging
Transcript: ENSMUST00000101398
AA Change: S79P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000098946
Gene: ENSMUSG00000046782
AA Change: S79P

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000172939
AA Change: S79P

SMART Domains

Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: S79P

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	486	495	N/A	INTRINSIC
low complexity region	670	685	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC
TPR	889	922	2e-4	SMART
TPR	957	989	2.36e1	SMART
TPR	990	1022	2.63e1	SMART
TPR	1023	1056	9.39e-1	SMART
TPR	1057	1090	3.78e-5	SMART
Blast:TPR	1126	1157	1e-11	BLAST
SEL1	1160	1192	3.39e1	SMART
TPR	1160	1194	4.44e1	SMART
TPR	1195	1228	7.87e0	SMART
Blast:TPR	1229	1262	1e-11	BLAST
TPR	1297	1330	1.24e0	SMART
SEL1	1341	1372	9.26e-1	SMART
TPR	1341	1374	3.45e-8	SMART
TPR	1375	1407	8.76e-1	SMART
TPR	1408	1441	1.45e-1	SMART
TPR	1442	1475	1.36e1	SMART
TPR	1476	1509	7.34e-3	SMART
TPR	1513	1546	1.01e0	SMART
TPR	1547	1580	2.55e-2	SMART
TPR	1581	1617	2.43e1	SMART
Blast:TPR	1618	1651	4e-12	BLAST
TPR	1652	1685	7.87e0	SMART
TPR	1686	1718	2.35e-1	SMART
SEL1	1719	1750	1.21e2	SMART
TPR	1719	1752	1.65e-5	SMART
TPR	1753	1786	1.66e-1	SMART
TPR	1787	1820	1.45e-1	SMART
TPR	1821	1854	3.27e0	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,304,644	D246G	probably damaging	Het
Abca13	A	G	11: 9,297,203	S2317G	probably benign	Het
Acap2	A	C	16: 31,108,116	L502R	probably benign	Het
Amotl2	A	G	9: 102,728,350	E467G	probably damaging	Het
Apbb1ip	A	T	2: 22,853,135		probably null	Het
Armc9	C	G	1: 86,162,715	D77E	probably benign	Het
Art1	T	A	7: 102,106,324	S8T	possibly damaging	Het
Asic5	G	A	3: 82,009,565	A321T	possibly damaging	Het
Astn2	A	G	4: 66,185,375	I267T	unknown	Het
Bmp8a	T	C	4: 123,342,389	N107S	probably benign	Het
Card14	T	A	11: 119,337,747	L633Q	probably damaging	Het
Chpf	C	T	1: 75,479,054	V18M	possibly damaging	Het
Cog7	T	C	7: 121,937,139	I493V	probably benign	Het
Col3a1	A	T	1: 45,347,811	N1394I	unknown	Het
Crybg1	C	T	10: 43,997,258	D1285N	probably benign	Het
Depdc7	A	G	2: 104,723,118	V395A	possibly damaging	Het
Dido1	G	A	2: 180,687,493	L379F	probably damaging	Het
Dnajc13	G	T	9: 104,238,514	T32N	probably benign	Het
Dok2	T	A	14: 70,776,028	S133R	probably benign	Het
Ehbp1l1	C	T	19: 5,716,382	R1311H	probably damaging	Het
Gm15922	T	C	7: 3,737,494	T243A	probably damaging	Het
Gm3099	A	T	14: 4,000,520	N118I	probably damaging	Het
Gtse1	A	G	15: 85,871,547	T471A	probably benign	Het
Heg1	G	A	16: 33,760,790	A13T	possibly damaging	Het
Ifi209	A	T	1: 173,642,590	Y248F	possibly damaging	Het
Itgb3bp	C	G	4: 99,769,521	E169Q	probably damaging	Het
Kcna2	A	G	3: 107,104,750	T216A	probably benign	Het
Kcnj6	A	T	16: 94,941,183	M10K	probably benign	Het
Krt17	T	G	11: 100,257,337	Q397P	probably benign	Het
Lrtm1	T	A	14: 29,022,118	M181K	probably damaging	Het
Map3k5	A	G	10: 20,099,555	H741R	probably damaging	Het
Mier1	T	A	4: 103,139,402	Y120*	probably null	Het
Mrvi1	T	C	7: 110,899,724	T367A	possibly damaging	Het
Myh14	T	A	7: 44,629,991	T922S	probably benign	Het
Nfkbie	A	T	17: 45,560,141	I240F	possibly damaging	Het
Npas3	C	A	12: 54,069,041	H915Q	probably damaging	Het
Nrg2	A	T	18: 36,045,941	V314E	probably benign	Het
Olfr373	T	A	8: 72,100,346	Y195*	probably null	Het
Pds5a	T	C	5: 65,619,734	N28S	probably damaging	Het
Pkhd1l1	A	T	15: 44,498,482	N517I	possibly damaging	Het
Plekhb1	T	C	7: 100,645,667	Y99C	probably benign	Het
Plpp6	T	C	19: 28,964,217	S73P	probably benign	Het
Polb	T	C	8: 22,639,959	N199S	probably benign	Het
Ppp1r13b	T	C	12: 111,872,406	N13D	possibly damaging	Het
Ptprn2	T	A	12: 117,248,544	V862D	probably damaging	Het
Rassf4	T	C	6: 116,640,317	I242M	probably damaging	Het
Rnf19a	G	A	15: 36,254,452	T320I	probably damaging	Het
Sctr	A	T	1: 120,022,240	E53V	probably damaging	Het
Srcin1	T	C	11: 97,551,693	D103G	probably benign	Het
St3gal3	T	C	4: 117,957,436	Q220R		Het
Stk40	G	A	4: 126,125,690	E86K	probably benign	Het
Tas2r104	T	A	6: 131,685,042	I235F	possibly damaging	Het
Terf2ip	T	C	8: 112,011,648	V56A	possibly damaging	Het
Thsd7b	A	G	1: 130,103,153	N1075S	probably benign	Het
Trak1	A	G	9: 121,416,212	Y51C	probably benign	Het
Trav16n	T	A	14: 53,351,402	V45E	probably benign	Het
Unc79	C	T	12: 103,063,190	T484M	probably damaging	Het
Usp49	T	C	17: 47,672,871	V267A	possibly damaging	Het
Vldlr	T	A	19: 27,238,604	D305E	possibly damaging	Het
Vmn1r226	G	T	17: 20,687,749	C81F	probably damaging	Het
Vmn1r73	T	C	7: 11,756,897	V214A	probably damaging	Het
Vmn2r5	T	C	3: 64,504,250	N299S	probably damaging	Het
Vwa3b	T	C	1: 37,164,505	L55S	probably damaging	Het
Wdr90	T	C	17: 25,851,506	D1105G	probably benign	Het
Zbtb38	A	G	9: 96,687,427	S535P	probably damaging	Het
Zfp329	T	C	7: 12,810,899	I233V	probably damaging	Het
Zfp579	T	A	7: 4,994,583	T110S	probably benign	Het

Other mutations in Ttc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03278:Ttc6	APN	12	57622026	missense	probably damaging	0.99
IGL02802:Ttc6	UTSW	12	57575868	missense	probably benign	0.14
PIT4802001:Ttc6	UTSW	12	57725676	missense	possibly damaging	0.89
R0698:Ttc6	UTSW	12	57673216	missense	probably benign	0.04
R0988:Ttc6	UTSW	12	57688649	splice site	probably benign
R1290:Ttc6	UTSW	12	57660413	missense	probably benign	0.00
R1338:Ttc6	UTSW	12	57616369	missense	probably benign	0.10
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1481:Ttc6	UTSW	12	57737130	missense	probably damaging	1.00
R1488:Ttc6	UTSW	12	57649515	missense	possibly damaging	0.66
R1558:Ttc6	UTSW	12	57686346	missense	probably benign	0.14
R1570:Ttc6	UTSW	12	57674763	missense	probably damaging	0.98
R1619:Ttc6	UTSW	12	57737668	missense	possibly damaging	0.73
R1819:Ttc6	UTSW	12	57694500	critical splice donor site	probably null
R1826:Ttc6	UTSW	12	57660247	missense	probably benign	0.10
R1863:Ttc6	UTSW	12	57714095	missense	probably benign	0.04
R1872:Ttc6	UTSW	12	57704552	critical splice donor site	probably null
R1887:Ttc6	UTSW	12	57673258	missense	probably benign	0.04
R1937:Ttc6	UTSW	12	57616323	missense	probably benign	0.02
R2014:Ttc6	UTSW	12	57576217	missense	possibly damaging	0.92
R2056:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2058:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2059:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2152:Ttc6	UTSW	12	57705552	missense	probably damaging	0.98
R2179:Ttc6	UTSW	12	57673118	missense	possibly damaging	0.62
R2275:Ttc6	UTSW	12	57702298	missense	probably benign	0.01
R2432:Ttc6	UTSW	12	57622035	missense	possibly damaging	0.79
R2474:Ttc6	UTSW	12	57575927	missense	probably benign	0.37
R2853:Ttc6	UTSW	12	57576181	missense	probably damaging	0.96
R3848:Ttc6	UTSW	12	57677146	missense	probably damaging	0.97
R3853:Ttc6	UTSW	12	57728549	missense	possibly damaging	0.88
R3950:Ttc6	UTSW	12	57649506	missense	probably damaging	0.97
R3953:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3954:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3955:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3957:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R4135:Ttc6	UTSW	12	57632795	intron	probably benign
R4387:Ttc6	UTSW	12	57643050	missense	probably benign	0.00
R4577:Ttc6	UTSW	12	57576655	missense	probably benign	0.22
R4747:Ttc6	UTSW	12	57674692	missense	possibly damaging	0.86
R4779:Ttc6	UTSW	12	57729451	missense	probably damaging	1.00
R4803:Ttc6	UTSW	12	57728505	missense	probably damaging	1.00
R4871:Ttc6	UTSW	12	57702356	missense	probably damaging	0.96
R4898:Ttc6	UTSW	12	57660240	missense	probably benign	0.00
R4930:Ttc6	UTSW	12	57673823	critical splice donor site	probably null
R4946:Ttc6	UTSW	12	57643140	missense	probably benign	0.01
R5257:Ttc6	UTSW	12	57702275	missense	possibly damaging	0.92
R5303:Ttc6	UTSW	12	57575820	missense	possibly damaging	0.90
R5385:Ttc6	UTSW	12	57643035	splice site	probably null
R5402:Ttc6	UTSW	12	57737031	nonsense	probably null
R5428:Ttc6	UTSW	12	57689834	missense	probably null	0.98
R5436:Ttc6	UTSW	12	57674594	splice site	probably null
R5646:Ttc6	UTSW	12	57576019	missense	probably damaging	0.99
R5697:Ttc6	UTSW	12	57677214	missense	probably benign	0.22
R5792:Ttc6	UTSW	12	57673204	missense	possibly damaging	0.71
R5808:Ttc6	UTSW	12	57617611	missense	possibly damaging	0.84
R5842:Ttc6	UTSW	12	57737016	missense	probably damaging	1.00
R5935:Ttc6	UTSW	12	57673804	missense	probably damaging	0.98
R6144:Ttc6	UTSW	12	57673100	missense	possibly damaging	0.83
R6155:Ttc6	UTSW	12	57737616	missense	possibly damaging	0.84
R6283:Ttc6	UTSW	12	57702262	missense	possibly damaging	0.95
R6371:Ttc6	UTSW	12	57728463	missense	possibly damaging	0.89
R6715:Ttc6	UTSW	12	57674770	critical splice donor site	probably null
R6738:Ttc6	UTSW	12	57688640	missense	probably damaging	0.99
R6795:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R6959:Ttc6	UTSW	12	57658142	splice site	probably null
R7053:Ttc6	UTSW	12	57660532	missense	probably benign	0.01
R7125:Ttc6	UTSW	12	57576339	missense	probably benign	0.00
R7259:Ttc6	UTSW	12	57576184	missense	probably benign	0.00
R7369:Ttc6	UTSW	12	57672931	critical splice acceptor site	probably null
R7409:Ttc6	UTSW	12	57696986	missense	probably damaging	0.99
R7429:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7430:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7492:Ttc6	UTSW	12	57673136	missense	probably benign	0.02
R7535:Ttc6	UTSW	12	57576519	missense	probably benign	0.00
R7866:Ttc6	UTSW	12	57674649	missense	probably damaging	0.97
R7901:Ttc6	UTSW	12	57688567	missense	probably damaging	1.00
R7944:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7945:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7965:Ttc6	UTSW	12	57673756	missense	possibly damaging	0.85
R8062:Ttc6	UTSW	12	57736978	missense	possibly damaging	0.90
R8119:Ttc6	UTSW	12	57705643	missense	possibly damaging	0.78
R8142:Ttc6	UTSW	12	57697472	missense	possibly damaging	0.87
R8154:Ttc6	UTSW	12	57729424	missense	probably damaging	1.00
R8171:Ttc6	UTSW	12	57673310	missense	probably damaging	1.00
R8335:Ttc6	UTSW	12	57660291	missense	probably benign	0.00
R8343:Ttc6	UTSW	12	57660496	missense	possibly damaging	0.47
X0021:Ttc6	UTSW	12	57576118	missense	probably damaging	0.96
X0058:Ttc6	UTSW	12	57706851	missense	probably damaging	0.99
Z1176:Ttc6	UTSW	12	57697375	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGAGAAGATTCGCCAGAAAACC -3'
(R):5'- CGTCAATATCGCTGCTCAGG -3'

Sequencing Primer
(F):5'- CCAAGAAGGATTATGAGCAACTC -3'
(R):5'- AATATCGCTGCTCAGGCTGGAC -3'

Posted On

2019-06-26