Mutagenetix > Incidental Mutations

Incidental Mutation 'R7304:Ptprn2'

567186

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.344) question?

Stock #

R7304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 117248544 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 862 (V862D)

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070733
AA Change: V862D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: V862D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190247
AA Change: V862D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: V862D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,304,644	D246G	probably damaging	Het
Abca13	A	G	11: 9,297,203	S2317G	probably benign	Het
Acap2	A	C	16: 31,108,116	L502R	probably benign	Het
Amotl2	A	G	9: 102,728,350	E467G	probably damaging	Het
Apbb1ip	A	T	2: 22,853,135		probably null	Het
Armc9	C	G	1: 86,162,715	D77E	probably benign	Het
Art1	T	A	7: 102,106,324	S8T	possibly damaging	Het
Asic5	G	A	3: 82,009,565	A321T	possibly damaging	Het
Astn2	A	G	4: 66,185,375	I267T	unknown	Het
Bmp8a	T	C	4: 123,342,389	N107S	probably benign	Het
Card14	T	A	11: 119,337,747	L633Q	probably damaging	Het
Chpf	C	T	1: 75,479,054	V18M	possibly damaging	Het
Cog7	T	C	7: 121,937,139	I493V	probably benign	Het
Col3a1	A	T	1: 45,347,811	N1394I	unknown	Het
Crybg1	C	T	10: 43,997,258	D1285N	probably benign	Het
Depdc7	A	G	2: 104,723,118	V395A	possibly damaging	Het
Dido1	G	A	2: 180,687,493	L379F	probably damaging	Het
Dnajc13	G	T	9: 104,238,514	T32N	probably benign	Het
Dok2	T	A	14: 70,776,028	S133R	probably benign	Het
Ehbp1l1	C	T	19: 5,716,382	R1311H	probably damaging	Het
Gm15922	T	C	7: 3,737,494	T243A	probably damaging	Het
Gm3099	A	T	14: 4,000,520	N118I	probably damaging	Het
Gtse1	A	G	15: 85,871,547	T471A	probably benign	Het
Heg1	G	A	16: 33,760,790	A13T	possibly damaging	Het
Ifi209	A	T	1: 173,642,590	Y248F	possibly damaging	Het
Itgb3bp	C	G	4: 99,769,521	E169Q	probably damaging	Het
Kcna2	A	G	3: 107,104,750	T216A	probably benign	Het
Kcnj6	A	T	16: 94,941,183	M10K	probably benign	Het
Krt17	T	G	11: 100,257,337	Q397P	probably benign	Het
Lrtm1	T	A	14: 29,022,118	M181K	probably damaging	Het
Map3k5	A	G	10: 20,099,555	H741R	probably damaging	Het
Mier1	T	A	4: 103,139,402	Y120*	probably null	Het
Mrvi1	T	C	7: 110,899,724	T367A	possibly damaging	Het
Myh14	T	A	7: 44,629,991	T922S	probably benign	Het
Nfkbie	A	T	17: 45,560,141	I240F	possibly damaging	Het
Npas3	C	A	12: 54,069,041	H915Q	probably damaging	Het
Nrg2	A	T	18: 36,045,941	V314E	probably benign	Het
Olfr373	T	A	8: 72,100,346	Y195*	probably null	Het
Pds5a	T	C	5: 65,619,734	N28S	probably damaging	Het
Pkhd1l1	A	T	15: 44,498,482	N517I	possibly damaging	Het
Plekhb1	T	C	7: 100,645,667	Y99C	probably benign	Het
Plpp6	T	C	19: 28,964,217	S73P	probably benign	Het
Polb	T	C	8: 22,639,959	N199S	probably benign	Het
Ppp1r13b	T	C	12: 111,872,406	N13D	possibly damaging	Het
Rassf4	T	C	6: 116,640,317	I242M	probably damaging	Het
Rnf19a	G	A	15: 36,254,452	T320I	probably damaging	Het
Sctr	A	T	1: 120,022,240	E53V	probably damaging	Het
Srcin1	T	C	11: 97,551,693	D103G	probably benign	Het
St3gal3	T	C	4: 117,957,436	Q220R		Het
Stk40	G	A	4: 126,125,690	E86K	probably benign	Het
Tas2r104	T	A	6: 131,685,042	I235F	possibly damaging	Het
Terf2ip	T	C	8: 112,011,648	V56A	possibly damaging	Het
Thsd7b	A	G	1: 130,103,153	N1075S	probably benign	Het
Trak1	A	G	9: 121,416,212	Y51C	probably benign	Het
Trav16n	T	A	14: 53,351,402	V45E	probably benign	Het
Ttc6	T	C	12: 57,576,051	S79P	probably damaging	Het
Unc79	C	T	12: 103,063,190	T484M	probably damaging	Het
Usp49	T	C	17: 47,672,871	V267A	possibly damaging	Het
Vldlr	T	A	19: 27,238,604	D305E	possibly damaging	Het
Vmn1r226	G	T	17: 20,687,749	C81F	probably damaging	Het
Vmn1r73	T	C	7: 11,756,897	V214A	probably damaging	Het
Vmn2r5	T	C	3: 64,504,250	N299S	probably damaging	Het
Vwa3b	T	C	1: 37,164,505	L55S	probably damaging	Het
Wdr90	T	C	17: 25,851,506	D1105G	probably benign	Het
Zbtb38	A	G	9: 96,687,427	S535P	probably damaging	Het
Zfp329	T	C	7: 12,810,899	I233V	probably damaging	Het
Zfp579	T	A	7: 4,994,583	T110S	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TGTGTCCCCTGATCTAAACCAG -3'
(R):5'- CAAAACCTGAGAGACCTGGC -3'

Sequencing Primer
(F):5'- CCAGCTAAACTCAGAGCAGAGG -3'
(R):5'- TAGTCGCTACAGTCTGCAGCATG -3'

Posted On

2019-06-26