Incidental Mutation 'R7304:Wdr90'
ID 567198
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene Name WD repeat domain 90
Synonyms 3230401M21Rik
MMRRC Submission 045365-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7304 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 26063745-26080475 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26070480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1105 (D1105G)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079461] [ENSMUST00000176923]
AlphaFold Q6ZPG2
Predicted Effect probably benign
Transcript: ENSMUST00000079461
AA Change: D1105G

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: D1105G

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176678
Predicted Effect probably benign
Transcript: ENSMUST00000176923
AA Change: D1087G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: D1087G

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,247,203 (GRCm39) S2317G probably benign Het
Acap2 A C 16: 30,926,934 (GRCm39) L502R probably benign Het
Amotl2 A G 9: 102,605,549 (GRCm39) E467G probably damaging Het
Apbb1ip A T 2: 22,743,147 (GRCm39) probably null Het
Armc9 C G 1: 86,090,437 (GRCm39) D77E probably benign Het
Art1 T A 7: 101,755,531 (GRCm39) S8T possibly damaging Het
Asic5 G A 3: 81,916,872 (GRCm39) A321T possibly damaging Het
Astn2 A G 4: 66,103,612 (GRCm39) I267T unknown Het
Bmp8a T C 4: 123,236,182 (GRCm39) N107S probably benign Het
Card14 T A 11: 119,228,573 (GRCm39) L633Q probably damaging Het
Chpf C T 1: 75,455,698 (GRCm39) V18M possibly damaging Het
Cog7 T C 7: 121,536,362 (GRCm39) I493V probably benign Het
Col3a1 A T 1: 45,386,971 (GRCm39) N1394I unknown Het
Crybg1 C T 10: 43,873,254 (GRCm39) D1285N probably benign Het
Depdc7 A G 2: 104,553,463 (GRCm39) V395A possibly damaging Het
Dido1 G A 2: 180,329,286 (GRCm39) L379F probably damaging Het
Dnajc13 G T 9: 104,115,713 (GRCm39) T32N probably benign Het
Dok2 T A 14: 71,013,468 (GRCm39) S133R probably benign Het
Ehbp1l1 C T 19: 5,766,410 (GRCm39) R1311H probably damaging Het
Gm3099 A T 14: 15,346,488 (GRCm39) N118I probably damaging Het
Gtse1 A G 15: 85,755,748 (GRCm39) T471A probably benign Het
Heg1 G A 16: 33,581,160 (GRCm39) A13T possibly damaging Het
Ifi209 A T 1: 173,470,156 (GRCm39) Y248F possibly damaging Het
Irag1 T C 7: 110,498,931 (GRCm39) T367A possibly damaging Het
Itgb3bp C G 4: 99,657,758 (GRCm39) E169Q probably damaging Het
Kcna2 A G 3: 107,012,066 (GRCm39) T216A probably benign Het
Kcnj6 A T 16: 94,742,042 (GRCm39) M10K probably benign Het
Krt17 T G 11: 100,148,163 (GRCm39) Q397P probably benign Het
Lrtm1 T A 14: 28,744,075 (GRCm39) M181K probably damaging Het
Map3k5 A G 10: 19,975,301 (GRCm39) H741R probably damaging Het
Mier1 T A 4: 102,996,599 (GRCm39) Y120* probably null Het
Myh14 T A 7: 44,279,415 (GRCm39) T922S probably benign Het
Nfkbie A T 17: 45,871,067 (GRCm39) I240F possibly damaging Het
Npas3 C A 12: 54,115,824 (GRCm39) H915Q probably damaging Het
Nrg2 A T 18: 36,178,994 (GRCm39) V314E probably benign Het
Or2z9 T A 8: 72,854,190 (GRCm39) Y195* probably null Het
Pds5a T C 5: 65,777,077 (GRCm39) N28S probably damaging Het
Pira1 T C 7: 3,740,493 (GRCm39) T243A probably damaging Het
Pkhd1l1 A T 15: 44,361,878 (GRCm39) N517I possibly damaging Het
Plekhb1 T C 7: 100,294,874 (GRCm39) Y99C probably benign Het
Plpp6 T C 19: 28,941,617 (GRCm39) S73P probably benign Het
Polb T C 8: 23,129,975 (GRCm39) N199S probably benign Het
Ppp1r13b T C 12: 111,838,840 (GRCm39) N13D possibly damaging Het
Prorp A G 12: 55,351,429 (GRCm39) D246G probably damaging Het
Ptprn2 T A 12: 117,212,164 (GRCm39) V862D probably damaging Het
Rassf4 T C 6: 116,617,278 (GRCm39) I242M probably damaging Het
Rnf19a G A 15: 36,254,598 (GRCm39) T320I probably damaging Het
Sctr A T 1: 119,949,970 (GRCm39) E53V probably damaging Het
Srcin1 T C 11: 97,442,519 (GRCm39) D103G probably benign Het
St3gal3 T C 4: 117,814,633 (GRCm39) Q220R Het
Stk40 G A 4: 126,019,483 (GRCm39) E86K probably benign Het
Tas2r104 T A 6: 131,662,005 (GRCm39) I235F possibly damaging Het
Terf2ip T C 8: 112,738,280 (GRCm39) V56A possibly damaging Het
Thsd7b A G 1: 130,030,890 (GRCm39) N1075S probably benign Het
Trak1 A G 9: 121,245,278 (GRCm39) Y51C probably benign Het
Trav16n T A 14: 53,588,859 (GRCm39) V45E probably benign Het
Ttc6 T C 12: 57,622,837 (GRCm39) S79P probably damaging Het
Unc79 C T 12: 103,029,449 (GRCm39) T484M probably damaging Het
Usp49 T C 17: 47,983,796 (GRCm39) V267A possibly damaging Het
Vldlr T A 19: 27,216,004 (GRCm39) D305E possibly damaging Het
Vmn1r226 G T 17: 20,908,011 (GRCm39) C81F probably damaging Het
Vmn1r73 T C 7: 11,490,824 (GRCm39) V214A probably damaging Het
Vmn2r5 T C 3: 64,411,671 (GRCm39) N299S probably damaging Het
Vwa3b T C 1: 37,203,586 (GRCm39) L55S probably damaging Het
Zbtb38 A G 9: 96,569,480 (GRCm39) S535P probably damaging Het
Zfp329 T C 7: 12,544,826 (GRCm39) I233V probably damaging Het
Zfp579 T A 7: 4,997,582 (GRCm39) T110S probably benign Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 26,068,338 (GRCm39) missense probably damaging 1.00
IGL01118:Wdr90 APN 17 26,073,661 (GRCm39) missense probably damaging 1.00
IGL01964:Wdr90 APN 17 26,067,383 (GRCm39) missense probably benign
IGL02116:Wdr90 APN 17 26,078,466 (GRCm39) missense probably benign 0.12
IGL02172:Wdr90 APN 17 26,069,408 (GRCm39) missense probably benign 0.22
IGL02716:Wdr90 APN 17 26,076,194 (GRCm39) missense probably damaging 0.96
IGL02961:Wdr90 APN 17 26,067,649 (GRCm39) nonsense probably null
IGL03229:Wdr90 APN 17 26,064,437 (GRCm39) splice site probably benign
IGL03367:Wdr90 APN 17 26,066,765 (GRCm39) splice site probably benign
IGL03098:Wdr90 UTSW 17 26,078,961 (GRCm39) intron probably benign
R0111:Wdr90 UTSW 17 26,067,418 (GRCm39) splice site probably benign
R0454:Wdr90 UTSW 17 26,079,023 (GRCm39) missense probably damaging 0.96
R0457:Wdr90 UTSW 17 26,079,459 (GRCm39) missense probably benign 0.00
R0488:Wdr90 UTSW 17 26,067,591 (GRCm39) missense probably damaging 1.00
R0622:Wdr90 UTSW 17 26,074,632 (GRCm39) missense probably damaging 1.00
R0671:Wdr90 UTSW 17 26,065,367 (GRCm39) missense probably benign 0.04
R0799:Wdr90 UTSW 17 26,079,104 (GRCm39) missense probably benign 0.38
R1177:Wdr90 UTSW 17 26,065,028 (GRCm39) missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 26,079,422 (GRCm39) missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 26,073,027 (GRCm39) missense probably damaging 1.00
R1468:Wdr90 UTSW 17 26,073,027 (GRCm39) missense probably damaging 1.00
R1544:Wdr90 UTSW 17 26,068,284 (GRCm39) missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 26,074,173 (GRCm39) missense probably benign 0.05
R2087:Wdr90 UTSW 17 26,065,577 (GRCm39) missense probably damaging 1.00
R2159:Wdr90 UTSW 17 26,070,715 (GRCm39) missense probably benign
R2208:Wdr90 UTSW 17 26,079,362 (GRCm39) missense probably damaging 1.00
R2345:Wdr90 UTSW 17 26,078,136 (GRCm39) missense probably benign 0.05
R2391:Wdr90 UTSW 17 26,070,429 (GRCm39) missense probably damaging 1.00
R2394:Wdr90 UTSW 17 26,070,429 (GRCm39) missense probably damaging 1.00
R2520:Wdr90 UTSW 17 26,074,326 (GRCm39) missense probably damaging 1.00
R3798:Wdr90 UTSW 17 26,069,472 (GRCm39) missense probably benign 0.01
R3979:Wdr90 UTSW 17 26,078,252 (GRCm39) missense probably benign 0.00
R4111:Wdr90 UTSW 17 26,068,342 (GRCm39) missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 26,072,705 (GRCm39) missense probably benign 0.25
R4459:Wdr90 UTSW 17 26,079,976 (GRCm39) missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 26,074,337 (GRCm39) missense probably benign 0.03
R4735:Wdr90 UTSW 17 26,078,424 (GRCm39) missense probably benign
R4907:Wdr90 UTSW 17 26,079,624 (GRCm39) intron probably benign
R5070:Wdr90 UTSW 17 26,065,307 (GRCm39) missense probably damaging 1.00
R5230:Wdr90 UTSW 17 26,074,277 (GRCm39) missense probably benign 0.01
R5268:Wdr90 UTSW 17 26,069,819 (GRCm39) missense probably damaging 1.00
R5287:Wdr90 UTSW 17 26,080,441 (GRCm39) utr 5 prime probably benign
R5382:Wdr90 UTSW 17 26,064,572 (GRCm39) missense probably damaging 1.00
R5511:Wdr90 UTSW 17 26,063,995 (GRCm39) unclassified probably benign
R5545:Wdr90 UTSW 17 26,064,830 (GRCm39) missense probably damaging 1.00
R5707:Wdr90 UTSW 17 26,076,166 (GRCm39) missense probably benign 0.00
R5973:Wdr90 UTSW 17 26,065,381 (GRCm39) missense probably damaging 1.00
R5973:Wdr90 UTSW 17 26,064,107 (GRCm39) missense probably damaging 0.99
R6385:Wdr90 UTSW 17 26,067,504 (GRCm39) missense probably damaging 1.00
R6481:Wdr90 UTSW 17 26,064,885 (GRCm39) missense probably damaging 0.99
R7078:Wdr90 UTSW 17 26,068,623 (GRCm39) missense probably damaging 1.00
R7214:Wdr90 UTSW 17 26,064,367 (GRCm39) missense probably benign 0.00
R7288:Wdr90 UTSW 17 26,065,286 (GRCm39) missense probably benign 0.03
R7309:Wdr90 UTSW 17 26,079,676 (GRCm39) missense probably benign 0.02
R7391:Wdr90 UTSW 17 26,065,502 (GRCm39) missense probably benign 0.08
R7622:Wdr90 UTSW 17 26,073,083 (GRCm39) missense probably benign 0.00
R7646:Wdr90 UTSW 17 26,079,104 (GRCm39) missense probably benign 0.38
R7772:Wdr90 UTSW 17 26,080,465 (GRCm39) start gained probably benign
R7779:Wdr90 UTSW 17 26,065,300 (GRCm39) missense probably damaging 1.00
R7780:Wdr90 UTSW 17 26,065,300 (GRCm39) missense probably damaging 1.00
R7781:Wdr90 UTSW 17 26,065,300 (GRCm39) missense probably damaging 1.00
R7782:Wdr90 UTSW 17 26,065,300 (GRCm39) missense probably damaging 1.00
R7812:Wdr90 UTSW 17 26,071,532 (GRCm39) missense probably damaging 1.00
R7870:Wdr90 UTSW 17 26,079,513 (GRCm39) missense probably damaging 0.96
R7911:Wdr90 UTSW 17 26,069,723 (GRCm39) missense probably benign 0.00
R8126:Wdr90 UTSW 17 26,067,951 (GRCm39) missense possibly damaging 0.48
R8260:Wdr90 UTSW 17 26,064,141 (GRCm39) missense probably damaging 1.00
R8315:Wdr90 UTSW 17 26,064,399 (GRCm39) missense probably benign 0.21
R8919:Wdr90 UTSW 17 26,076,146 (GRCm39) missense
R8938:Wdr90 UTSW 17 26,076,146 (GRCm39) missense
R8940:Wdr90 UTSW 17 26,076,146 (GRCm39) missense
R9038:Wdr90 UTSW 17 26,076,200 (GRCm39) missense
R9079:Wdr90 UTSW 17 26,076,403 (GRCm39) missense
R9401:Wdr90 UTSW 17 26,064,750 (GRCm39) small insertion probably benign
R9471:Wdr90 UTSW 17 26,080,015 (GRCm39) missense possibly damaging 0.72
R9642:Wdr90 UTSW 17 26,072,694 (GRCm39) critical splice donor site probably null
X0064:Wdr90 UTSW 17 26,067,537 (GRCm39) missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 26,079,470 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGAACAACAGCTACCTGG -3'
(R):5'- ATTCAGGCTTAGCTGGGAGAG -3'

Sequencing Primer
(F):5'- TGGCCCGACAGCACTAAG -3'
(R):5'- GAGGGCATGACCGTGTTAG -3'
Posted On 2019-06-26