Mutagenetix > Incidental Mutation

Incidental Mutation 'R7304:Vldlr'

567203

Institutional Source

Beutler Lab

Gene Symbol

Vldlr

Ensembl Gene

ENSMUSG00000024924

Gene Name

very low density lipoprotein receptor

Synonyms

AA408956, AI451093, AW047288, VLDL receptor

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R7304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27216484-27254231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27238604 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 305 (D305E)

Ref Sequence

ENSEMBL: ENSMUSP00000127329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000164746] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]

AlphaFold

P98156

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025866
AA Change: D305E

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
Blast:LY	461	495	4e-15	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047645
AA Change: D264E

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: D264E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	1.25e-14	SMART
LDLa	112	149	7.15e-15	SMART
LDLa	151	190	1.23e-13	SMART
LDLa	197	234	1.1e-15	SMART
LDLa	236	273	1.13e-12	SMART
LDLa	276	316	3.86e-11	SMART
EGF_CA	315	354	1e-5	SMART
EGF_CA	355	394	6.1e-10	SMART
LY	420	462	2.16e-1	SMART
LY	464	506	9.54e-12	SMART
LY	507	550	2.22e-12	SMART
LY	551	593	1.66e-11	SMART
LY	594	637	5.97e-4	SMART
EGF	664	709	2.16e-1	SMART
transmembrane domain	728	750	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164746

SMART Domains

Protein: ENSMUSP00000128193
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
LDLa	32	69	1.69e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165761

SMART Domains

Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
LDLa	1	26	1.58e0	SMART
EGF	28	64	4e-5	SMART
LY	88	130	2.16e-1	SMART
LY	132	174	9.54e-12	SMART
LY	175	218	2.22e-12	SMART
LY	219	258	3.25e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167487
AA Change: D305E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	797	819	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172302
AA Change: D305E

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	769	791	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	G	12: 55,304,644	D246G	probably damaging	Het
Abca13	A	G	11: 9,297,203	S2317G	probably benign	Het
Acap2	A	C	16: 31,108,116	L502R	probably benign	Het
Amotl2	A	G	9: 102,728,350	E467G	probably damaging	Het
Apbb1ip	A	T	2: 22,853,135		probably null	Het
Armc9	C	G	1: 86,162,715	D77E	probably benign	Het
Art1	T	A	7: 102,106,324	S8T	possibly damaging	Het
Asic5	G	A	3: 82,009,565	A321T	possibly damaging	Het
Astn2	A	G	4: 66,185,375	I267T	unknown	Het
Bmp8a	T	C	4: 123,342,389	N107S	probably benign	Het
Card14	T	A	11: 119,337,747	L633Q	probably damaging	Het
Chpf	C	T	1: 75,479,054	V18M	possibly damaging	Het
Cog7	T	C	7: 121,937,139	I493V	probably benign	Het
Col3a1	A	T	1: 45,347,811	N1394I	unknown	Het
Crybg1	C	T	10: 43,997,258	D1285N	probably benign	Het
Depdc7	A	G	2: 104,723,118	V395A	possibly damaging	Het
Dido1	G	A	2: 180,687,493	L379F	probably damaging	Het
Dnajc13	G	T	9: 104,238,514	T32N	probably benign	Het
Dok2	T	A	14: 70,776,028	S133R	probably benign	Het
Ehbp1l1	C	T	19: 5,716,382	R1311H	probably damaging	Het
Gm15922	T	C	7: 3,737,494	T243A	probably damaging	Het
Gm3099	A	T	14: 4,000,520	N118I	probably damaging	Het
Gtse1	A	G	15: 85,871,547	T471A	probably benign	Het
Heg1	G	A	16: 33,760,790	A13T	possibly damaging	Het
Ifi209	A	T	1: 173,642,590	Y248F	possibly damaging	Het
Itgb3bp	C	G	4: 99,769,521	E169Q	probably damaging	Het
Kcna2	A	G	3: 107,104,750	T216A	probably benign	Het
Kcnj6	A	T	16: 94,941,183	M10K	probably benign	Het
Krt17	T	G	11: 100,257,337	Q397P	probably benign	Het
Lrtm1	T	A	14: 29,022,118	M181K	probably damaging	Het
Map3k5	A	G	10: 20,099,555	H741R	probably damaging	Het
Mier1	T	A	4: 103,139,402	Y120*	probably null	Het
Mrvi1	T	C	7: 110,899,724	T367A	possibly damaging	Het
Myh14	T	A	7: 44,629,991	T922S	probably benign	Het
Nfkbie	A	T	17: 45,560,141	I240F	possibly damaging	Het
Npas3	C	A	12: 54,069,041	H915Q	probably damaging	Het
Nrg2	A	T	18: 36,045,941	V314E	probably benign	Het
Olfr373	T	A	8: 72,100,346	Y195*	probably null	Het
Pds5a	T	C	5: 65,619,734	N28S	probably damaging	Het
Pkhd1l1	A	T	15: 44,498,482	N517I	possibly damaging	Het
Plekhb1	T	C	7: 100,645,667	Y99C	probably benign	Het
Plpp6	T	C	19: 28,964,217	S73P	probably benign	Het
Polb	T	C	8: 22,639,959	N199S	probably benign	Het
Ppp1r13b	T	C	12: 111,872,406	N13D	possibly damaging	Het
Ptprn2	T	A	12: 117,248,544	V862D	probably damaging	Het
Rassf4	T	C	6: 116,640,317	I242M	probably damaging	Het
Rnf19a	G	A	15: 36,254,452	T320I	probably damaging	Het
Sctr	A	T	1: 120,022,240	E53V	probably damaging	Het
Srcin1	T	C	11: 97,551,693	D103G	probably benign	Het
St3gal3	T	C	4: 117,957,436	Q220R		Het
Stk40	G	A	4: 126,125,690	E86K	probably benign	Het
Tas2r104	T	A	6: 131,685,042	I235F	possibly damaging	Het
Terf2ip	T	C	8: 112,011,648	V56A	possibly damaging	Het
Thsd7b	A	G	1: 130,103,153	N1075S	probably benign	Het
Trak1	A	G	9: 121,416,212	Y51C	probably benign	Het
Trav16n	T	A	14: 53,351,402	V45E	probably benign	Het
Ttc6	T	C	12: 57,576,051	S79P	probably damaging	Het
Unc79	C	T	12: 103,063,190	T484M	probably damaging	Het
Usp49	T	C	17: 47,672,871	V267A	possibly damaging	Het
Vmn1r226	G	T	17: 20,687,749	C81F	probably damaging	Het
Vmn1r73	T	C	7: 11,756,897	V214A	probably damaging	Het
Vmn2r5	T	C	3: 64,504,250	N299S	probably damaging	Het
Vwa3b	T	C	1: 37,164,505	L55S	probably damaging	Het
Wdr90	T	C	17: 25,851,506	D1105G	probably benign	Het
Zbtb38	A	G	9: 96,687,427	S535P	probably damaging	Het
Zfp329	T	C	7: 12,810,899	I233V	probably damaging	Het
Zfp579	T	A	7: 4,994,583	T110S	probably benign	Het

Other mutations in Vldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01346:Vldlr	APN	19	27239681	missense	possibly damaging	0.93
IGL01575:Vldlr	APN	19	27246631	missense	probably benign
IGL01626:Vldlr	APN	19	27243773	missense	probably damaging	1.00
IGL02213:Vldlr	APN	19	27241326	missense	probably benign	0.09
IGL02365:Vldlr	APN	19	27245625	missense	probably damaging	1.00
IGL02488:Vldlr	APN	19	27238275	missense	probably damaging	1.00
IGL02708:Vldlr	APN	19	27238085	missense	possibly damaging	0.92
IGL02947:Vldlr	APN	19	27239720	missense	probably benign	0.03
disturbed	UTSW	19	27238804	nonsense	probably null
r26	UTSW	19	27245654	missense	probably damaging	0.99
spotty	UTSW	19	27238792	missense	probably damaging	1.00
PIT4142001:Vldlr	UTSW	19	27234869	missense	probably benign	0.05
R0195:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R0288:Vldlr	UTSW	19	27240651	splice site	probably benign
R0536:Vldlr	UTSW	19	27239964	missense	probably damaging	1.00
R0537:Vldlr	UTSW	19	27247918	missense	probably damaging	1.00
R0542:Vldlr	UTSW	19	27236255	missense	probably benign	0.01
R0594:Vldlr	UTSW	19	27234819	missense	probably damaging	1.00
R0624:Vldlr	UTSW	19	27238263	missense	possibly damaging	0.91
R0726:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R1017:Vldlr	UTSW	19	27241333	missense	probably damaging	1.00
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1443:Vldlr	UTSW	19	27239721	missense	possibly damaging	0.91
R1493:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1520:Vldlr	UTSW	19	27240543	missense	probably damaging	0.99
R1520:Vldlr	UTSW	19	27247066	missense	possibly damaging	0.96
R1657:Vldlr	UTSW	19	27245670	missense	probably benign	0.00
R1901:Vldlr	UTSW	19	27241309	missense	probably damaging	1.00
R2047:Vldlr	UTSW	19	27234838	missense	probably damaging	1.00
R2258:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R2273:Vldlr	UTSW	19	27248015	missense	probably damaging	1.00
R2423:Vldlr	UTSW	19	27236288	missense	possibly damaging	0.49
R3196:Vldlr	UTSW	19	27243154	missense	probably damaging	0.98
R3752:Vldlr	UTSW	19	27238331	missense	probably damaging	1.00
R3801:Vldlr	UTSW	19	27217621	missense	probably damaging	0.99
R3835:Vldlr	UTSW	19	27234814	missense	probably damaging	1.00
R4027:Vldlr	UTSW	19	27238313	missense	probably benign
R4301:Vldlr	UTSW	19	27238402	missense	possibly damaging	0.80
R4470:Vldlr	UTSW	19	27234819	missense	probably damaging	0.96
R4541:Vldlr	UTSW	19	27238792	missense	probably damaging	1.00
R4765:Vldlr	UTSW	19	27240547	missense	probably damaging	1.00
R4771:Vldlr	UTSW	19	27239890	missense	probably damaging	0.97
R4795:Vldlr	UTSW	19	27238852	splice site	probably null
R4839:Vldlr	UTSW	19	27238065	missense	probably damaging	1.00
R5074:Vldlr	UTSW	19	27238277	missense	probably damaging	1.00
R5134:Vldlr	UTSW	19	27238812	nonsense	probably null
R5281:Vldlr	UTSW	19	27244231	missense	probably benign	0.44
R5466:Vldlr	UTSW	19	27239843	critical splice acceptor site	probably null
R5514:Vldlr	UTSW	19	27244224	missense	probably damaging	0.97
R5886:Vldlr	UTSW	19	27243771	missense	probably benign	0.03
R5889:Vldlr	UTSW	19	27239664	missense	probably damaging	1.00
R6110:Vldlr	UTSW	19	27238077	missense	possibly damaging	0.92
R6343:Vldlr	UTSW	19	27245649	missense	probably damaging	0.99
R6833:Vldlr	UTSW	19	27240574	missense	probably damaging	1.00
R6838:Vldlr	UTSW	19	27247970	missense	probably damaging	1.00
R7169:Vldlr	UTSW	19	27244328	missense	probably benign
R7197:Vldlr	UTSW	19	27234841	missense	probably benign	0.36
R7403:Vldlr	UTSW	19	27236274	nonsense	probably null
R7658:Vldlr	UTSW	19	27243136	missense	probably benign	0.33
R7754:Vldlr	UTSW	19	27217615	start codon destroyed	probably benign	0.01
R8105:Vldlr	UTSW	19	27238804	nonsense	probably null
R8377:Vldlr	UTSW	19	27234858	missense	probably damaging	1.00
R8529:Vldlr	UTSW	19	27230256	missense	probably benign	0.03
R8777:Vldlr	UTSW	19	27240546	missense	probably benign	0.00
R8777-TAIL:Vldlr	UTSW	19	27240546	missense	probably benign	0.00
R9380:Vldlr	UTSW	19	27238792	missense	possibly damaging	0.63
R9400:Vldlr	UTSW	19	27238775	missense	probably damaging	0.99
R9483:Vldlr	UTSW	19	27246631	missense	probably benign	0.00
R9502:Vldlr	UTSW	19	27241342	missense	probably damaging	1.00
R9509:Vldlr	UTSW	19	27244287	missense	probably benign	0.44
R9630:Vldlr	UTSW	19	27230223	missense	probably damaging	1.00
R9767:Vldlr	UTSW	19	27234874	missense	probably damaging	1.00
R9768:Vldlr	UTSW	19	27241320	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- AGGTCAACTGCCGTAAGTAAC -3'
(R):5'- GCAGTCTTGTTCCTGGTCAC -3'

Sequencing Primer
(F):5'- GTCAACTGCCGTAAGTAACTTTCCAG -3'
(R):5'- GGTCACATACTTTGCTCATGTCTATG -3'

Posted On

2019-06-26