Incidental Mutation 'R0636:Slc3a1'
ID56721
Institutional Source Beutler Lab
Gene Symbol Slc3a1
Ensembl Gene ENSMUSG00000024131
Gene Namesolute carrier family 3, member 1
SynonymsNTAA, D2H
MMRRC Submission 038825-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0636 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85028347-85064243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85032794 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 215 (T215S)
Ref Sequence ENSEMBL: ENSMUSP00000024944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024944
AA Change: T215S

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024944
Gene: ENSMUSG00000024131
AA Change: T215S

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
Aamy 124 504 6.7e-110 SMART
Meta Mutation Damage Score 0.7076 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II membrane glycoprotein which is one of the components of the renal amino acid transporter which transports neutral and basic amino acids in the renal tubule and intestinal tract. Mutations and deletions in this gene are associated with cystinuria. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus results in renal absorption defects and cystine urolithiasis. Homozygous mutant mice serve as a mouse model for human cystinuria type I. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,231,217 Y264C probably damaging Het
8030423J24Rik T C 13: 70,884,225 F139L unknown Het
Aco1 A G 4: 40,175,697 E146G probably damaging Het
Adam2 T G 14: 66,034,816 D639A probably benign Het
Adh4 G T 3: 138,428,074 R315L probably damaging Het
Adprhl1 T C 8: 13,248,702 D76G probably damaging Het
AF366264 T C 8: 13,837,870 R74G probably benign Het
Akip1 T C 7: 109,707,519 probably benign Het
Ap3d1 T A 10: 80,719,382 K370* probably null Het
Arfgef1 C A 1: 10,199,851 V358L probably benign Het
Arpp21 A T 9: 112,183,498 D85E probably benign Het
Azi2 A T 9: 118,062,057 L383F probably benign Het
Bpgm T A 6: 34,504,287 D206E probably benign Het
Bsn T C 9: 108,107,834 D3007G unknown Het
Ccdc142 T G 6: 83,107,198 probably benign Het
Cep135 T C 5: 76,615,657 V498A probably benign Het
Cntn6 A T 6: 104,863,148 Q1003L probably benign Het
Cntnap2 T A 6: 47,296,708 probably benign Het
Csf2rb2 G A 15: 78,291,960 Q139* probably null Het
Cyp3a16 A G 5: 145,463,085 V101A probably benign Het
D630045J12Rik T C 6: 38,196,778 T152A probably benign Het
Def8 G A 8: 123,454,357 W176* probably null Het
Dgkg A G 16: 22,579,729 probably benign Het
Ear10 T C 14: 43,922,994 probably null Het
Fbxw2 A T 2: 34,822,847 Y67* probably null Het
Flii T A 11: 60,715,552 Y1104F probably damaging Het
Gm973 G A 1: 59,551,144 R270K probably benign Het
Gm9833 T C 3: 10,088,783 L204P possibly damaging Het
Gnl3 T A 14: 31,017,153 K75N probably damaging Het
Gpc6 A T 14: 117,624,493 M274L probably benign Het
Ifi47 A G 11: 49,096,651 E415G possibly damaging Het
Ift57 A G 16: 49,711,896 T130A probably benign Het
Itpr2 T A 6: 146,171,412 D2373V probably damaging Het
Kat6a T C 8: 22,939,323 S1565P possibly damaging Het
Klhl6 A T 16: 19,948,073 probably benign Het
Klra2 T C 6: 131,220,104 probably benign Het
Lama5 A G 2: 180,189,331 probably null Het
Mapk4 A G 18: 73,930,454 S566P probably benign Het
Mindy4 C A 6: 55,276,585 R480S possibly damaging Het
Mterf3 T C 13: 66,922,753 probably benign Het
Mtmr2 A G 9: 13,801,913 probably null Het
Naip5 T C 13: 100,219,688 T1140A probably benign Het
Nf1 A G 11: 79,535,703 T1648A probably damaging Het
Nlk A T 11: 78,695,844 D141E probably benign Het
Noxa1 C A 2: 25,086,094 probably benign Het
Olfr1279 A G 2: 111,306,412 N69S probably benign Het
Olfr1480 A T 19: 13,530,249 Y236F possibly damaging Het
Olfr476 T C 7: 107,967,472 V25A probably benign Het
Otog G A 7: 46,264,228 probably null Het
Pebp4 T C 14: 70,048,347 probably benign Het
Phgdh G T 3: 98,333,291 N100K possibly damaging Het
Pnisr T A 4: 21,873,800 probably benign Het
Ptpn6 T C 6: 124,725,279 H346R probably benign Het
Rsf1 T C 7: 97,662,019 V652A possibly damaging Het
Rubcn G A 16: 32,828,686 H624Y probably damaging Het
Setdb2 T C 14: 59,406,704 N656D probably benign Het
Slc22a23 T C 13: 34,299,093 T268A probably benign Het
Srsf2 A G 11: 116,852,078 S206P probably benign Het
Susd2 T A 10: 75,639,350 D542V probably damaging Het
Svep1 G A 4: 58,073,121 Q2063* probably null Het
Syne2 G A 12: 75,930,983 V1401M possibly damaging Het
Tenm2 A G 11: 36,943,976 L64P probably damaging Het
Tigd2 A G 6: 59,211,287 T380A possibly damaging Het
Trmt12 G T 15: 58,873,985 V411F probably damaging Het
Ubr4 T C 4: 139,436,302 probably null Het
Ush2a G A 1: 188,822,738 C3571Y probably benign Het
Usp8 A G 2: 126,720,110 M75V possibly damaging Het
Vcan C T 13: 89,704,706 D712N probably damaging Het
Vcan C A 13: 89,712,267 R327L probably damaging Het
Vps8 A G 16: 21,434,933 E8G probably benign Het
Washc5 T C 15: 59,359,409 D335G probably benign Het
Zbtb39 A G 10: 127,742,835 N426S probably benign Het
Zfp184 T A 13: 21,949,749 D55E probably damaging Het
Zfp882 T C 8: 71,914,337 V336A probably benign Het
Other mutations in Slc3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc3a1 APN 17 85060833 missense probably damaging 1.00
IGL00647:Slc3a1 APN 17 85063805 missense probably damaging 0.99
IGL02755:Slc3a1 APN 17 85037177 missense probably damaging 1.00
IGL03079:Slc3a1 APN 17 85059823 nonsense probably null
IGL03390:Slc3a1 APN 17 85032777 missense probably damaging 1.00
R0031:Slc3a1 UTSW 17 85032846 missense probably damaging 1.00
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0363:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R0531:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R0662:Slc3a1 UTSW 17 85037207 missense possibly damaging 0.89
R0725:Slc3a1 UTSW 17 85060835 nonsense probably null
R0930:Slc3a1 UTSW 17 85059743 missense probably benign 0.01
R1141:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R2025:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R2271:Slc3a1 UTSW 17 85063792 missense probably benign 0.00
R4196:Slc3a1 UTSW 17 85060878 missense probably damaging 1.00
R4740:Slc3a1 UTSW 17 85046753 missense probably benign 0.00
R5049:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R5255:Slc3a1 UTSW 17 85028453 unclassified probably null
R5261:Slc3a1 UTSW 17 85051975 missense probably damaging 1.00
R5601:Slc3a1 UTSW 17 85032891 missense probably benign 0.00
R5853:Slc3a1 UTSW 17 85032580 missense probably damaging 1.00
R6063:Slc3a1 UTSW 17 85028523 missense probably benign
R6332:Slc3a1 UTSW 17 85028432 start codon destroyed probably damaging 0.99
R7162:Slc3a1 UTSW 17 85064014 nonsense probably null
R7269:Slc3a1 UTSW 17 85032445 missense probably damaging 1.00
R7516:Slc3a1 UTSW 17 85063762 missense probably damaging 1.00
R7807:Slc3a1 UTSW 17 85063943 missense probably benign 0.09
X0020:Slc3a1 UTSW 17 85028808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTTGCTGCCATCCATGACAAAG -3'
(R):5'- TTTCCAACCTGAAGGGCTTCCCAC -3'

Sequencing Primer
(F):5'- TGCCATCCATGACAAAGGTAAAG -3'
(R):5'- ACTTGTCCAGCTCAGTGAGTC -3'
Posted On2013-07-11