Incidental Mutation 'R7305:Idh3b'
ID567213
Institutional Source Beutler Lab
Gene Symbol Idh3b
Ensembl Gene ENSMUSG00000027406
Gene Nameisocitrate dehydrogenase 3 (NAD+) beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130279309-130284547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130281493 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 192 (K192N)
Ref Sequence ENSEMBL: ENSMUSP00000028892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
Predicted Effect probably benign
Transcript: ENSMUST00000028890
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000028892
AA Change: K192N

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406
AA Change: K192N

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103198
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136621
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect probably benign
Transcript: ENSMUST00000146454
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150401
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159373
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp3a57 A G 5: 145,370,985 I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Etl4 A T 2: 20,709,557 I156F probably damaging Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Itgb2 A C 10: 77,548,564 D173A probably damaging Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
R3hdm2 A G 10: 127,476,678 N430D probably benign Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Zbtb21 T C 16: 97,951,295 H596R possibly damaging Het
Other mutations in Idh3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Idh3b APN 2 130281897 missense possibly damaging 0.87
IGL02821:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03057:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03106:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03159:Idh3b APN 2 130284401 missense probably benign 0.00
R0090:Idh3b UTSW 2 130280979 missense probably benign 0.01
R1191:Idh3b UTSW 2 130281890 missense probably benign 0.43
R1443:Idh3b UTSW 2 130284054 splice site probably null
R1634:Idh3b UTSW 2 130281745 missense probably benign 0.39
R1644:Idh3b UTSW 2 130281510 missense possibly damaging 0.95
R5784:Idh3b UTSW 2 130279671 missense probably damaging 1.00
R5847:Idh3b UTSW 2 130284028 missense probably benign 0.00
R6469:Idh3b UTSW 2 130279673 frame shift probably null
R6473:Idh3b UTSW 2 130279673 frame shift probably null
R6532:Idh3b UTSW 2 130279673 frame shift probably null
R6536:Idh3b UTSW 2 130279673 frame shift probably null
R6959:Idh3b UTSW 2 130281527 missense probably damaging 1.00
R7019:Idh3b UTSW 2 130280966 missense probably damaging 1.00
R7505:Idh3b UTSW 2 130284227 missense probably benign
R7505:Idh3b UTSW 2 130284233 missense probably benign
R7608:Idh3b UTSW 2 130280980 missense probably damaging 1.00
R7887:Idh3b UTSW 2 130281758 missense probably damaging 1.00
R8165:Idh3b UTSW 2 130280500 missense possibly damaging 0.73
Z1176:Idh3b UTSW 2 130281542 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCCTCACAGCACTGCAAG -3'
(R):5'- CCTGGTTATCATTCGAGAGCAG -3'

Sequencing Primer
(F):5'- AACAAGCCATCCCCTAGTTTCCTG -3'
(R):5'- TTATCATTCGAGAGCAGACAGAAG -3'
Posted On2019-06-26