Incidental Mutation 'R7305:Cyp3a57'
ID567226
Institutional Source Beutler Lab
Gene Symbol Cyp3a57
Ensembl Gene ENSMUSG00000070419
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 57
SynonymsEG622127
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location145345279-145390926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145370985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 184 (I184V)
Ref Sequence ENSEMBL: ENSMUSP00000078251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079268] [ENSMUST00000174696]
Predicted Effect probably benign
Transcript: ENSMUST00000079268
AA Change: I184V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078251
Gene: ENSMUSG00000070419
AA Change: I184V

DomainStartEndE-ValueType
Pfam:p450 38 493 6.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174696
SMART Domains Protein: ENSMUSP00000133600
Gene: ENSMUSG00000070419

DomainStartEndE-ValueType
Pfam:p450 38 147 1.8e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Asap1 G A 15: 64,130,250 T404M probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Etl4 A T 2: 20,709,557 I156F probably damaging Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Idh3b C A 2: 130,281,493 K192N possibly damaging Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Itgb2 A C 10: 77,548,564 D173A probably damaging Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
R3hdm2 A G 10: 127,476,678 N430D probably benign Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Zbtb21 T C 16: 97,951,295 H596R possibly damaging Het
Other mutations in Cyp3a57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Cyp3a57 APN 5 145371024 missense probably damaging 1.00
IGL00656:Cyp3a57 APN 5 145372549 missense possibly damaging 0.55
IGL01368:Cyp3a57 APN 5 145369068 missense probably damaging 0.99
IGL01602:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01605:Cyp3a57 APN 5 145387044 missense probably damaging 1.00
IGL01924:Cyp3a57 APN 5 145372629 missense probably benign
IGL02191:Cyp3a57 APN 5 145365685 missense probably damaging 1.00
IGL02213:Cyp3a57 APN 5 145381280 missense probably damaging 1.00
IGL02217:Cyp3a57 APN 5 145369143 splice site probably null
R0141:Cyp3a57 UTSW 5 145362102 missense probably benign 0.05
R0720:Cyp3a57 UTSW 5 145390403 splice site probably benign
R0765:Cyp3a57 UTSW 5 145390410 splice site probably benign
R0976:Cyp3a57 UTSW 5 145390468 missense probably benign 0.01
R1494:Cyp3a57 UTSW 5 145381267 missense probably damaging 0.97
R1624:Cyp3a57 UTSW 5 145390415 critical splice acceptor site probably null
R1732:Cyp3a57 UTSW 5 145365645 missense probably damaging 1.00
R1791:Cyp3a57 UTSW 5 145371010 missense probably benign 0.06
R1839:Cyp3a57 UTSW 5 145381301 missense probably damaging 1.00
R1858:Cyp3a57 UTSW 5 145381249 missense probably damaging 1.00
R2095:Cyp3a57 UTSW 5 145369134 nonsense probably null
R2305:Cyp3a57 UTSW 5 145381280 missense probably damaging 1.00
R3954:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R4289:Cyp3a57 UTSW 5 145349397 missense probably damaging 1.00
R4463:Cyp3a57 UTSW 5 145381274 missense probably damaging 1.00
R4579:Cyp3a57 UTSW 5 145374264 missense probably benign 0.00
R4598:Cyp3a57 UTSW 5 145390417 missense probably benign 0.01
R4678:Cyp3a57 UTSW 5 145370728 splice site probably null
R4853:Cyp3a57 UTSW 5 145365679 missense probably damaging 1.00
R4954:Cyp3a57 UTSW 5 145370955 critical splice acceptor site probably null
R4977:Cyp3a57 UTSW 5 145349426 splice site probably null
R5162:Cyp3a57 UTSW 5 145369083 missense probably damaging 1.00
R5226:Cyp3a57 UTSW 5 145365697 missense probably benign 0.04
R5470:Cyp3a57 UTSW 5 145372619 missense probably benign 0.12
R5568:Cyp3a57 UTSW 5 145370646 missense probably benign 0.01
R5652:Cyp3a57 UTSW 5 145349325 critical splice acceptor site probably null
R5872:Cyp3a57 UTSW 5 145371057 nonsense probably null
R6855:Cyp3a57 UTSW 5 145372566 missense probably damaging 0.97
R6861:Cyp3a57 UTSW 5 145370963 missense possibly damaging 0.85
R6893:Cyp3a57 UTSW 5 145386974 nonsense probably null
R7081:Cyp3a57 UTSW 5 145381373 missense probably damaging 1.00
Z1177:Cyp3a57 UTSW 5 145365633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACATCAGGTAAAGGCCAAG -3'
(R):5'- ATAGGGAGCTGGGCATTTCC -3'

Sequencing Primer
(F):5'- CATCAGGTAAAGGCCAAGGTGTG -3'
(R):5'- CATTTCCTTATGGTGAGGAGGAAAG -3'
Posted On2019-06-26