Incidental Mutation 'R7305:Asap1'
ID567273
Institutional Source Beutler Lab
Gene Symbol Asap1
Ensembl Gene ENSMUSG00000022377
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain1
SynonymsDdef1, mKIAA1249
Accession Numbers

Genbank: NM_010026; MGI: 1342335

Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R7305 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location64086857-64382919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64130250 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 404 (T404M)
Ref Sequence ENSEMBL: ENSMUSP00000135643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023008] [ENSMUST00000110114] [ENSMUST00000110115] [ENSMUST00000175793] [ENSMUST00000175799] [ENSMUST00000176014] [ENSMUST00000176384] [ENSMUST00000177035] [ENSMUST00000177083] [ENSMUST00000177371] [ENSMUST00000177374]
Predicted Effect probably damaging
Transcript: ENSMUST00000023008
AA Change: T427M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023008
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110114
AA Change: T427M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105741
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110115
AA Change: T412M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105742
Gene: ENSMUSG00000022377
AA Change: T412M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 799 832 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
SH3 1073 1131 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175793
AA Change: T415M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135718
Gene: ENSMUSG00000022377
AA Change: T415M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 328 421 4.12e-15 SMART
ArfGap 442 565 2.18e-34 SMART
ANK 603 635 1.17e-1 SMART
ANK 639 668 3.46e-4 SMART
low complexity region 715 726 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 802 835 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 959 972 N/A INTRINSIC
low complexity region 1053 1065 N/A INTRINSIC
SH3 1076 1134 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175799
AA Change: T424M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135359
Gene: ENSMUSG00000022377
AA Change: T424M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 911 924 N/A INTRINSIC
low complexity region 1005 1017 N/A INTRINSIC
SH3 1028 1086 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176014
AA Change: T424M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135172
Gene: ENSMUSG00000022377
AA Change: T424M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 811 844 N/A INTRINSIC
low complexity region 853 862 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
SH3 1085 1143 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176384
AA Change: T427M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135190
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177035
AA Change: T412M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135346
Gene: ENSMUSG00000022377
AA Change: T412M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 899 912 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
SH3 1016 1074 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177083
AA Change: T392M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134877
Gene: ENSMUSG00000022377
AA Change: T392M

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 305 398 4.12e-15 SMART
ArfGap 419 542 2.18e-34 SMART
ANK 580 612 1.17e-1 SMART
ANK 616 645 3.46e-4 SMART
low complexity region 692 703 N/A INTRINSIC
low complexity region 757 768 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 821 830 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
SH3 1053 1111 3.29e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177371
AA Change: T404M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135643
Gene: ENSMUSG00000022377
AA Change: T404M

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 317 410 4.12e-15 SMART
ArfGap 431 554 2.18e-34 SMART
ANK 592 624 1.17e-1 SMART
ANK 628 657 3.46e-4 SMART
low complexity region 704 715 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 824 N/A INTRINSIC
low complexity region 833 842 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
SH3 1065 1123 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177374
AA Change: T427M

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134825
Gene: ENSMUSG00000022377
AA Change: T427M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:BAR 18 267 1.8e-11 PFAM
Pfam:BAR_3 52 286 1.2e-29 PFAM
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,285,119 I4019K probably benign Het
9130011E15Rik A T 19: 45,892,121 M508K probably benign Het
Abhd16b A T 2: 181,493,416 D37V possibly damaging Het
Ankhd1 A G 18: 36,632,205 D87G Het
Ankrd31 A G 13: 96,878,971 S1583G probably damaging Het
Ankub1 T C 3: 57,692,517 probably benign Het
Apba3 A G 10: 81,271,233 D264G probably damaging Het
Cnot3 A T 7: 3,645,480 probably benign Het
Cxxc1 A G 18: 74,219,396 Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,928,189 probably null Het
Cyp3a57 A G 5: 145,370,985 I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,623,355 probably null Het
Dab1 T A 4: 104,713,790 D210E Het
Elavl1 G A 8: 4,325,199 probably benign Het
Emilin1 C T 5: 30,917,089 Q225* probably null Het
Eml6 G T 11: 29,777,258 A1288E probably benign Het
Eno1 T C 4: 150,245,339 probably null Het
Eprs C T 1: 185,379,701 R303C probably damaging Het
Eps15l1 G A 8: 72,373,034 A651V probably benign Het
Etl4 A T 2: 20,709,557 I156F probably damaging Het
Faim2 A T 15: 99,513,933 I171N probably damaging Het
Fam105a A G 15: 27,658,233 C184R probably benign Het
Fam135a T A 1: 24,030,858 N381I probably damaging Het
Fam160a1 G T 3: 85,730,524 P156Q probably damaging Het
Fam71d A G 12: 78,715,035 K158E possibly damaging Het
Gabrg3 T A 7: 56,735,085 M243L probably benign Het
Gm5134 A G 10: 76,000,399 I405V probably damaging Het
Gm6614 G A 6: 141,992,494 A253V probably damaging Het
Gm9376 A T 14: 118,267,356 K67* probably null Het
Grm8 A T 6: 27,761,355 I290K possibly damaging Het
Hao1 T A 2: 134,548,201 M73L probably benign Het
Herc1 A G 9: 66,461,868 D452G Het
Idh3b C A 2: 130,281,493 K192N possibly damaging Het
Igkv6-23 A G 6: 70,260,569 S63P probably benign Het
Itgb2 A C 10: 77,548,564 D173A probably damaging Het
Jmjd8 A T 17: 25,830,327 T255S probably benign Het
Lamc3 A C 2: 31,930,702 E1243A probably benign Het
Map1a A G 2: 121,299,458 T252A probably damaging Het
Mrgpra1 C A 7: 47,335,455 A159S probably benign Het
Ndst3 T C 3: 123,601,482 I500V possibly damaging Het
Nhsl1 A G 10: 18,531,686 T1523A possibly damaging Het
Nr2f1 A G 13: 78,195,179 I322T probably damaging Het
Nup210 T C 6: 91,087,966 E184G probably damaging Het
Obsl1 C T 1: 75,493,946 W1022* probably null Het
Olfr1250 T A 2: 89,656,502 H313L probably benign Het
Olfr166 T A 16: 19,487,699 I287N probably damaging Het
Olfr470 A T 7: 107,845,365 Y123N probably damaging Het
Olfr551 G T 7: 102,587,955 Q263K possibly damaging Het
Olfr802 A T 10: 129,682,280 I153N probably damaging Het
Olfr808 T A 10: 129,767,851 Y118* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Parp8 A G 13: 116,894,925 L417P possibly damaging Het
Pdia6 A G 12: 17,274,508 Q120R probably benign Het
Ppp3cc T C 14: 70,240,803 N290S probably benign Het
Prdm5 C A 6: 65,831,260 S63R possibly damaging Het
Prr14l T C 5: 32,831,101 D350G probably benign Het
Pwwp2a T C 11: 43,717,051 L497S probably damaging Het
R3hdm2 A G 10: 127,476,678 N430D probably benign Het
Rad51ap2 A G 12: 11,457,343 N422S possibly damaging Het
Rbbp8 G A 18: 11,672,581 probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,579,918 probably benign Het
Slc22a6 G A 19: 8,622,158 probably null Het
Slc28a3 T A 13: 58,566,231 E440V possibly damaging Het
Slc30a5 A T 13: 100,811,424 I482K probably damaging Het
Slco1a1 A T 6: 141,924,497 F305Y probably damaging Het
Slco4c1 T C 1: 96,828,965 N544S probably damaging Het
Smpd4 T A 16: 17,641,783 I656N probably damaging Het
Taok1 A T 11: 77,541,674 L771* probably null Het
Tmem231 T C 8: 111,915,295 D209G possibly damaging Het
Tmem25 A G 9: 44,795,408 probably null Het
Tmem79 T C 3: 88,333,411 T77A probably benign Het
Topbp1 A T 9: 103,328,637 T825S probably damaging Het
Trpm6 A T 19: 18,876,091 Q1825L probably benign Het
Uba1y T A Y: 821,348 D110E probably damaging Het
Utrn A T 10: 12,385,536 N3422K probably benign Het
Vmn1r219 A T 13: 23,163,144 M168L probably benign Het
Vmn2r62 T C 7: 42,764,811 H736R possibly damaging Het
Wdr1 T C 5: 38,540,092 H291R possibly damaging Het
Zan T C 5: 137,415,139 T3177A unknown Het
Zbtb21 T C 16: 97,951,295 H596R possibly damaging Het
Other mutations in Asap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Asap1 APN 15 64119954 splice site probably benign
IGL00473:Asap1 APN 15 64173215 splice site probably benign
IGL00519:Asap1 APN 15 64110942 missense probably damaging 1.00
IGL01304:Asap1 APN 15 64312449 missense probably damaging 1.00
IGL01510:Asap1 APN 15 64158928 missense probably damaging 1.00
IGL02208:Asap1 APN 15 64122033 missense probably damaging 1.00
IGL02338:Asap1 APN 15 64123670 critical splice donor site probably null
IGL02429:Asap1 APN 15 64167740 missense probably damaging 1.00
IGL02565:Asap1 APN 15 64129165 splice site probably benign
IGL02644:Asap1 APN 15 64111062 missense probably damaging 1.00
IGL02684:Asap1 APN 15 64094169 missense probably benign
IGL02707:Asap1 APN 15 64129274 missense probably damaging 1.00
IGL03052:Asap1 APN 15 64153834 splice site probably benign
IGL03153:Asap1 APN 15 64160274 missense probably damaging 1.00
A4554:Asap1 UTSW 15 64124711 splice site probably benign
PIT4378001:Asap1 UTSW 15 64135848 missense probably damaging 0.99
R0081:Asap1 UTSW 15 64099564 missense probably damaging 1.00
R0555:Asap1 UTSW 15 64094364 missense probably damaging 1.00
R1414:Asap1 UTSW 15 64158884 missense possibly damaging 0.92
R1437:Asap1 UTSW 15 64120107 missense probably damaging 0.96
R1474:Asap1 UTSW 15 64120020 missense probably benign 0.01
R1489:Asap1 UTSW 15 64172730 missense probably damaging 1.00
R1553:Asap1 UTSW 15 64152852 missense probably benign 0.31
R1603:Asap1 UTSW 15 64129257 missense probably damaging 1.00
R1636:Asap1 UTSW 15 64123912 missense probably damaging 1.00
R1645:Asap1 UTSW 15 64089475 missense probably damaging 0.99
R1861:Asap1 UTSW 15 64135798 splice site probably benign
R2136:Asap1 UTSW 15 64110959 missense probably damaging 1.00
R2351:Asap1 UTSW 15 64135804 critical splice donor site probably null
R4436:Asap1 UTSW 15 64349843 missense probably benign 0.03
R4618:Asap1 UTSW 15 64152895 missense probably damaging 1.00
R4868:Asap1 UTSW 15 64094181 missense probably benign
R5077:Asap1 UTSW 15 64127423 missense probably damaging 1.00
R5333:Asap1 UTSW 15 64127414 missense possibly damaging 0.79
R5391:Asap1 UTSW 15 64094052 missense possibly damaging 0.57
R5493:Asap1 UTSW 15 64130151 missense possibly damaging 0.85
R5665:Asap1 UTSW 15 64312453 missense probably damaging 1.00
R5756:Asap1 UTSW 15 64167707 missense probably damaging 1.00
R5790:Asap1 UTSW 15 64094265 missense probably damaging 1.00
R6139:Asap1 UTSW 15 64166539 missense possibly damaging 0.87
R6194:Asap1 UTSW 15 64129209 missense probably damaging 1.00
R6361:Asap1 UTSW 15 64349823 splice site probably null
R6751:Asap1 UTSW 15 64094412 missense possibly damaging 0.86
R7143:Asap1 UTSW 15 64191528 missense probably damaging 1.00
R7218:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7225:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7310:Asap1 UTSW 15 64099530 critical splice donor site probably null
R7439:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7441:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7488:Asap1 UTSW 15 64120125 missense probably benign 0.29
R7597:Asap1 UTSW 15 64312455 missense probably benign 0.37
R7708:Asap1 UTSW 15 64152872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACACAGAGAAGAGGCTCGAC -3'
(R):5'- TGTGTTCAAACAGCCCTAACC -3'

Sequencing Primer
(F):5'- TCGACAGGCCAGTGTGC -3'
(R):5'- GTGTTCAAACAGCCCTAACCATCTC -3'
Posted On2019-06-26