Incidental Mutation 'R7305:Trpm6'
ID 567283
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 045407-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7305 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 18727347-18869875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 18853455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1825 (Q1825L)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: Q1825L

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: Q1825L

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b A T 2: 181,135,209 (GRCm39) D37V possibly damaging Het
Ankhd1 A G 18: 36,765,258 (GRCm39) D87G Het
Ankrd31 A G 13: 97,015,479 (GRCm39) S1583G probably damaging Het
Ankub1 T C 3: 57,599,938 (GRCm39) probably benign Het
Apba3 A G 10: 81,107,067 (GRCm39) D264G probably damaging Het
Armh3 A T 19: 45,880,560 (GRCm39) M508K probably benign Het
Asap1 G A 15: 64,002,099 (GRCm39) T404M probably damaging Het
Cnot3 A T 7: 3,648,479 (GRCm39) probably benign Het
Cxxc1 A G 18: 74,352,467 (GRCm39) Y349C probably benign Het
Cyfip1 AGTGT AGT 7: 55,577,937 (GRCm39) probably null Het
Cyp3a57 A G 5: 145,307,795 (GRCm39) I184V probably benign Het
D130052B06Rik GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG 11: 33,573,355 (GRCm39) probably null Het
Dab1 T A 4: 104,570,987 (GRCm39) D210E Het
Elavl1 G A 8: 4,375,199 (GRCm39) probably benign Het
Emilin1 C T 5: 31,074,433 (GRCm39) Q225* probably null Het
Eml6 G T 11: 29,727,258 (GRCm39) A1288E probably benign Het
Eno1 T C 4: 150,329,796 (GRCm39) probably null Het
Eprs1 C T 1: 185,111,898 (GRCm39) R303C probably damaging Het
Eps15l1 G A 8: 73,126,878 (GRCm39) A651V probably benign Het
Etl4 A T 2: 20,714,368 (GRCm39) I156F probably damaging Het
Faim2 A T 15: 99,411,814 (GRCm39) I171N probably damaging Het
Fam135a T A 1: 24,069,939 (GRCm39) N381I probably damaging Het
Fhip1a G T 3: 85,637,831 (GRCm39) P156Q probably damaging Het
Gabrg3 T A 7: 56,384,833 (GRCm39) M243L probably benign Het
Garin2 A G 12: 78,761,809 (GRCm39) K158E possibly damaging Het
Gm5134 A G 10: 75,836,233 (GRCm39) I405V probably damaging Het
Gm9376 A T 14: 118,504,768 (GRCm39) K67* probably null Het
Grm8 A T 6: 27,761,354 (GRCm39) I290K possibly damaging Het
Hao1 T A 2: 134,390,121 (GRCm39) M73L probably benign Het
Herc1 A G 9: 66,369,150 (GRCm39) D452G Het
Idh3b C A 2: 130,123,413 (GRCm39) K192N possibly damaging Het
Igkv6-23 A G 6: 70,237,553 (GRCm39) S63P probably benign Het
Itgb2 A C 10: 77,384,398 (GRCm39) D173A probably damaging Het
Jmjd8 A T 17: 26,049,301 (GRCm39) T255S probably benign Het
Lamc3 A C 2: 31,820,714 (GRCm39) E1243A probably benign Het
Map1a A G 2: 121,129,939 (GRCm39) T252A probably damaging Het
Mrgpra1 C A 7: 46,985,203 (GRCm39) A159S probably benign Het
Ndst3 T C 3: 123,395,131 (GRCm39) I500V possibly damaging Het
Nhsl1 A G 10: 18,407,434 (GRCm39) T1523A possibly damaging Het
Nr2f1 A G 13: 78,343,298 (GRCm39) I322T probably damaging Het
Nup210 T C 6: 91,064,948 (GRCm39) E184G probably damaging Het
Obsl1 C T 1: 75,470,590 (GRCm39) W1022* probably null Het
Or2l13 T A 16: 19,306,449 (GRCm39) I287N probably damaging Het
Or4a77 T A 2: 89,486,846 (GRCm39) H313L probably benign Het
Or52p2 G T 7: 102,237,162 (GRCm39) Q263K possibly damaging Het
Or5p51 A T 7: 107,444,572 (GRCm39) Y123N probably damaging Het
Or6c1 A T 10: 129,518,149 (GRCm39) I153N probably damaging Het
Or6c65 T A 10: 129,603,720 (GRCm39) Y118* probably null Het
Otulinl A G 15: 27,658,319 (GRCm39) C184R probably benign Het
Oxr1 C T 15: 41,677,004 (GRCm39) P187L not run Het
Parp8 A G 13: 117,031,461 (GRCm39) L417P possibly damaging Het
Pdia6 A G 12: 17,324,509 (GRCm39) Q120R probably benign Het
Ppp3cc T C 14: 70,478,252 (GRCm39) N290S probably benign Het
Prdm5 C A 6: 65,808,244 (GRCm39) S63R possibly damaging Het
Prr14l T C 5: 32,988,445 (GRCm39) D350G probably benign Het
Pwwp2a T C 11: 43,607,878 (GRCm39) L497S probably damaging Het
R3hdm2 A G 10: 127,312,547 (GRCm39) N430D probably benign Het
Rad51ap2 A G 12: 11,507,344 (GRCm39) N422S possibly damaging Het
Rbbp8 G A 18: 11,805,638 (GRCm39) probably null Het
Rsf1 GGCGGCGGC GGCGGCGGCAGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Slc22a6 G A 19: 8,599,522 (GRCm39) probably null Het
Slc28a3 T A 13: 58,714,045 (GRCm39) E440V possibly damaging Het
Slc30a5 A T 13: 100,947,932 (GRCm39) I482K probably damaging Het
Slco1a1 A T 6: 141,870,223 (GRCm39) F305Y probably damaging Het
Slco1a8 G A 6: 141,938,220 (GRCm39) A253V probably damaging Het
Slco4c1 T C 1: 96,756,690 (GRCm39) N544S probably damaging Het
Smpd4 T A 16: 17,459,647 (GRCm39) I656N probably damaging Het
Spata31h1 A T 10: 82,120,953 (GRCm39) I4019K probably benign Het
Taok1 A T 11: 77,432,500 (GRCm39) L771* probably null Het
Tmem231 T C 8: 112,641,927 (GRCm39) D209G possibly damaging Het
Tmem25 A G 9: 44,706,705 (GRCm39) probably null Het
Tmem79 T C 3: 88,240,718 (GRCm39) T77A probably benign Het
Topbp1 A T 9: 103,205,836 (GRCm39) T825S probably damaging Het
Uba1y T A Y: 821,348 (GRCm39) D110E probably damaging Het
Utrn A T 10: 12,261,280 (GRCm39) N3422K probably benign Het
Vmn1r219 A T 13: 23,347,314 (GRCm39) M168L probably benign Het
Vmn2r62 T C 7: 42,414,235 (GRCm39) H736R possibly damaging Het
Wdr1 T C 5: 38,697,435 (GRCm39) H291R possibly damaging Het
Zan T C 5: 137,413,401 (GRCm39) T3177A unknown Het
Zbtb21 T C 16: 97,752,495 (GRCm39) H596R possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,761,272 (GRCm39) splice site probably benign
IGL00862:Trpm6 APN 19 18,804,892 (GRCm39) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,855,015 (GRCm39) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,803,158 (GRCm39) nonsense probably null
IGL01451:Trpm6 APN 19 18,786,933 (GRCm39) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,773,894 (GRCm39) nonsense probably null
IGL01995:Trpm6 APN 19 18,807,691 (GRCm39) splice site probably benign
IGL02092:Trpm6 APN 19 18,749,695 (GRCm39) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,809,903 (GRCm39) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,831,427 (GRCm39) missense probably benign
IGL02329:Trpm6 APN 19 18,831,581 (GRCm39) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,755,874 (GRCm39) splice site probably benign
IGL02402:Trpm6 APN 19 18,764,120 (GRCm39) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,804,762 (GRCm39) nonsense probably null
IGL02457:Trpm6 APN 19 18,803,155 (GRCm39) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,779,571 (GRCm39) splice site probably benign
IGL02705:Trpm6 APN 19 18,754,097 (GRCm39) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,787,016 (GRCm39) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,807,376 (GRCm39) splice site probably benign
IGL02818:Trpm6 APN 19 18,843,621 (GRCm39) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,790,846 (GRCm39) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,815,381 (GRCm39) nonsense probably null
IGL03193:Trpm6 APN 19 18,803,236 (GRCm39) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,764,143 (GRCm39) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,796,483 (GRCm39) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,796,545 (GRCm39) missense probably benign
IGL03245:Trpm6 APN 19 18,855,065 (GRCm39) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,815,446 (GRCm39) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,790,850 (GRCm39) missense probably benign
P0043:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,803,166 (GRCm39) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,764,119 (GRCm39) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,809,957 (GRCm39) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,796,558 (GRCm39) splice site probably null
R0267:Trpm6 UTSW 19 18,800,742 (GRCm39) missense probably benign
R0350:Trpm6 UTSW 19 18,861,321 (GRCm39) splice site probably null
R0373:Trpm6 UTSW 19 18,830,951 (GRCm39) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,756,008 (GRCm39) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,760,389 (GRCm39) splice site probably benign
R0505:Trpm6 UTSW 19 18,851,266 (GRCm39) splice site probably benign
R0526:Trpm6 UTSW 19 18,770,240 (GRCm39) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,849,585 (GRCm39) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,803,226 (GRCm39) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,815,451 (GRCm39) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,773,862 (GRCm39) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,773,859 (GRCm39) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,853,295 (GRCm39) missense probably benign
R1558:Trpm6 UTSW 19 18,764,192 (GRCm39) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,804,888 (GRCm39) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,854,995 (GRCm39) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,833,581 (GRCm39) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,804,931 (GRCm39) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,869,363 (GRCm39) splice site probably null
R1840:Trpm6 UTSW 19 18,843,631 (GRCm39) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,831,629 (GRCm39) missense probably benign
R2073:Trpm6 UTSW 19 18,853,406 (GRCm39) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,855,103 (GRCm39) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,803,116 (GRCm39) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,773,648 (GRCm39) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,790,714 (GRCm39) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,807,316 (GRCm39) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,769,454 (GRCm39) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,831,795 (GRCm39) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,749,757 (GRCm39) nonsense probably null
R3779:Trpm6 UTSW 19 18,853,403 (GRCm39) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,809,921 (GRCm39) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,804,889 (GRCm39) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,773,864 (GRCm39) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,809,841 (GRCm39) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,809,961 (GRCm39) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,803,236 (GRCm39) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,831,564 (GRCm39) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,853,428 (GRCm39) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,790,857 (GRCm39) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,845,345 (GRCm39) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,839,576 (GRCm39) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,764,124 (GRCm39) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,790,828 (GRCm39) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,807,297 (GRCm39) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,807,571 (GRCm39) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,830,968 (GRCm39) missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18,830,981 (GRCm39) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,764,183 (GRCm39) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,833,539 (GRCm39) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,869,383 (GRCm39) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6105:Trpm6 UTSW 19 18,831,112 (GRCm39) nonsense probably null
R6211:Trpm6 UTSW 19 18,760,492 (GRCm39) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,831,655 (GRCm39) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,831,472 (GRCm39) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,807,354 (GRCm39) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,815,406 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,866,384 (GRCm39) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,773,803 (GRCm39) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,807,661 (GRCm39) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,855,129 (GRCm39) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,760,527 (GRCm39) missense probably benign
R7103:Trpm6 UTSW 19 18,790,911 (GRCm39) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,831,397 (GRCm39) nonsense probably null
R7128:Trpm6 UTSW 19 18,789,137 (GRCm39) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,831,155 (GRCm39) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,854,150 (GRCm39) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,755,949 (GRCm39) missense probably benign 0.13
R7498:Trpm6 UTSW 19 18,853,484 (GRCm39) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,756,029 (GRCm39) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,809,945 (GRCm39) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,845,325 (GRCm39) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,853,377 (GRCm39) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,831,613 (GRCm39) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,804,772 (GRCm39) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,727,409 (GRCm39) splice site probably null
R7807:Trpm6 UTSW 19 18,807,220 (GRCm39) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,792,605 (GRCm39) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,754,074 (GRCm39) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,831,654 (GRCm39) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,853,474 (GRCm39) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,756,023 (GRCm39) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,792,714 (GRCm39) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,770,226 (GRCm39) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,789,154 (GRCm39) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,851,225 (GRCm39) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,831,332 (GRCm39) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,809,849 (GRCm39) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,869,459 (GRCm39) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,815,366 (GRCm39) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,792,799 (GRCm39) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,810,016 (GRCm39) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,815,462 (GRCm39) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,761,264 (GRCm39) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,755,978 (GRCm39) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,764,123 (GRCm39) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,853,394 (GRCm39) nonsense probably null
R9564:Trpm6 UTSW 19 18,851,240 (GRCm39) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,790,846 (GRCm39) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,869,466 (GRCm39) missense probably benign
R9721:Trpm6 UTSW 19 18,807,336 (GRCm39) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,800,766 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGAGCTGCCATGATTCAGGTG -3'
(R):5'- CAGGTTTCTAGACTGCCCAAC -3'

Sequencing Primer
(F):5'- CCATGATTCAGGTGCTGTCACAAG -3'
(R):5'- TACCCACAAAGCAAATGTCCTTTAC -3'
Posted On 2019-06-26